Want to add random string to identifier line in fasta file - perl

Question

I want to add random string to existing identifier line in fasta file.
So I get:
MMETSP0259|AmphidiniumcarteCMP1314aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Then the sequence on the next lines as normal. I am have problem with i think in the format output. This is what I get:
MMETSP0259|AmphidiniumCMP1314aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
CTTCATCGCACATGGATAACTGTGTACCTGACTaaaaaaaaaaaaaaaaaaaaaaaaaaaaaab
TCTGGGAAAGGTTGCTATCATGAGTCATAGAATaaaaaaaaaaaaaaaaaaaaaaaaaaaaaac
It's added to every line. (I altered length to fit here.) I want just to add to the identifier line.
This is what i have so far:
use strict;
use warnings;
my $currentId = "aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa";
my $header_line;
my $seq;
my $uniqueID;
open (my $fh,"$ARGV[0]") or die "Failed to open file: $!\n";
open (my $out_fh, ">$ARGV[0]_longer_ID_MMETSP.fasta");
while( <$fh> ){
if ($_ =~ m/^(\S+)\s+(.*)/) {
$header_line = $1;
$seq = $2;
$uniqueID = $currentId++;
print $out_fh "$header_line$uniqueID\n$seq";
} # if
} # while
close $fh;
close $out_fh;
Thanks very much, any ideas will be greatly appreciated.

Answer 1

Your program isn't working because the regex ^(\S+)\s+(.*) matches every line in the input file. For instance, \S+ matches CTTCATCGCACATGGATAACTGTGTACCTGACT; the newline at the end of the line matches \s+; and nothing matches .*.
Here's how I would encode your solution. It simply appends $current_id to the end of any line that contains a pipe | character
use strict;
use warnings;
use 5.010;
use autodie;
my ($filename) = #ARGV;
my $current_id = 'a' x 57;
open my $in_fh, '<', $filename;
open my $out_fh, '>', "${filename}_longer_ID_MMETSP.fasta";
while ( my $line = <$in_fh> ) {
chomp $line;
$line .= $current_id if $line =~ tr/|//;
print $line, "\n";
}
close $out_fh;
output
MMETSP0259|AmphidiniumCMP1314aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
CTTCATCGCACATGGATAACTGTGTACCTGACT
TCTGGGAAAGGTTGCTATCATGAGTCATAGAAT