Its posible to replace print result in perl output
Contents of Simple.csv:
string1
string2
string3
My script:
#!/usr/bin/perl
use strict;
use warnings;
my $file = 'simple.csv';
open my $info, $file or die "Could not open $file: $!";
while( my $line = <$info>) {
sleep(2);
print $line ;
}
close $info;
output its like:
string1
string2
string3
How to change the output in single line replace each other like string1 ..then replace string2... then replace string 3
Use printf to control the imposition of newline characters. Use a backspace (\b) to move backwards over the last output line, or simply issue a carriage-return (\r) to move to the beginning of the line. Line buffering is also disabled. Something like this meets your requirement (as I understand it):
#!/usr/bin/env perl
use strict;
use warnings;
my $file = 'simple.csv';
open my $info, '<', $file or die "Can't open '$file': $!\n";
$|++; #...don't buffer output...
while ( my $line = <$info> ) {
chomp $line; #...remove ending newline...
# printf "%s%s", $line, "\b" x length($line); # alternative-1
printf "%s\r", $line; # alternative-2
sleep 2;
}
close $info;
print "\n"; #...leave a clean output...
Hope, print statement itself can do that.
#!/usr/bin/perl
use strict;
use warnings;
my $file = 'simple.csv';
open my $info, $file or die "Could not open $file: $!";
while( my $line = <$info>) {
chomp($line);
print "$line\r";
sleep(2);
}
close $info;
This Carriage return moves to the beginning of the line for each print.
Related
I have a file which contains a list of email addresses which are separated by a semi-colon which is configured much like this (but much larger) :
$ cat email_casper.txt
casper1#foo.com; casper2#foo.com; casper3#foo.com; casper.casper4#foo.com;
#these throw outlook error :
#casper101#foo.com ; casper100#foo.com
#cat /tmp/emailist.txt | tr '\n' '; '
#cat /tmp/emallist.txt | perl -nle 'print /\<(.*)\>/' | sort
I want to break it up on the semicolon - so I suck the whole file into an array supposedly the contents are split on semicolon.
#!/usr/bin/perl
use strict;
use warnings;
my $filename = shift #ARGV ;
open(my $fh, '<', $filename) or die "Could not open file $filename $!";
my #values = split(';', $fh);
foreach my $val (#values) {
print "$val\n";
}
exit 0 ;
But the file awards me with a golb. I just don't know what is going one.
$ ./spliton_semi.pl email_casper.txt
GLOB(0x80070b90)
If I use Data::Dumper I get
#!/usr/bin/perl
use strict;
use warnings;
use Data::Dumper ;
my $filename = shift #ARGV ;
open(my $fh, '<', $filename) or die "Could not open file $filename $!";
my #values = split(';', $fh);
print Dumper \#values ;
This is what the Dumper returns :
$ ./spliton_semi.pl email_casper.txt
$VAR1 = [
'GLOB(0x80070b90)'
];
You do not "suck the whole file into an array". You don't even attempt to read from the file handle. Instead, you pass the file handle to split. Expecting a string, it stringifies the file handle into GLOB(0x80070b90).
You could read the file into an array of lines as follows:
my #lines = <$fh>;
for my $line ($lines) {
...
}
But it's far simpler to read one line at a time.
while ( my $line = <$fh> ) {
...
}
In fact, there is no reason not to use ARGV here, simplifying your program to the following:
#!/usr/bin/perl
use strict;
use warnings;
use feature qw( say );
while (<>) {
chomp;
say for split /\s*;\s*/, $_;
}
This line
my #values = split(';', $fh);
is not reading from the filehandle like you think it is. You're actually calling split on the filehandle object itself.
You want this:
my $line = <$fh>;
my #values = split(';', $line);
Starting point:
#!/usr/bin/perl
use strict;
use warnings;
open(my $fh, '<', 'dummy.txt')
or die "$!";
my #values;
while (<$fh>) {
chomp;
# original
# push(#values, split(';', $_));
# handle white space
push(#values, split(/\s*;\s*/, $_));
}
close($fh);
foreach my $val (#values) {
print "$val\n";
}
exit 0;
Output for your example:
$ perl dummy.pl
casper1#foo.com
casper2#foo.com
casper3#foo.com
casper.casper4#foo.com
I am trying to send a variable that is defined in an if statement $abc to a new file. The code seems correct but, I know that it is not working because the file is not being created.
Data File Sample:
bos,control,x1,x2,29AUG2016,y1,y2,76.4
bos,control,x2,x3,30AUG2016,y2,y3,78.9
bos,control,x3,x4,01SEP2016,y3,y4,72.5
bos,control,x4,x5,02SEP2016,y4,y5,80.5
Perl Code:
#!/usr/bin/perl
use strict;
use warnings 'all';
use POSIX qw(strftime); #Pull in date
my $currdate = strftime( "%Y%m%d", localtime ); #Date in YYYYMMDD format
my $modded = strftime( "%d%b%Y", localtime ); #Date in DDMONYYYY format
my $newdate = uc $modded; #converts lowercase to uppercase
my $filename = '/home/.../.../text_file'; #Define full file path before opening
open(FILE, '<', $filename) or die "Uh, where's the file again?\n"; #Open file else give up and relay snarky error
while(<FILE>) #Open While Loop
{
chomp;
my #fields = split(',' , $_); #Identify columns
my $site = $fields[0];
my $var1 = $fields[1];
my $var2 = $fields[4];
my $var3 = $fields[7];
my $abc = print "$var1,$var2,$var3\n" if ($var1 =~ "control" && $var2 =~ "$newdate");
open my $abc, '>', '/home/.../.../newfile.txt';
close $abc;
}
close FILE;
In your code you have a few odd things that are likely mistakes.
my $abc = print "$var1,$var2,$var3\n" if ($var1 =~ "c01" && $var2 =~ "$newdate");
print will return success, which it does as 1. So you will print out the string to STDOUT, and then assign 1 to a new lexical variable $abc. $abc is now 1.
All of that only happens if that condition is met. Don't do conditional assignments. The behavior for this is undefined. So if the condition is false, your $abc might be undef. Or something else. Who knows?
open my $abc, '>', '/home/.../.../newfile.txt';
close $abc;
You are opening a new filehandle called $abc. The my will redeclare it. That's a warning that you would get if you had use warnings in your code. It also overwrites your old $abc with a new file handle object.
You don't write anything to the file
... are weird foldernames, but that's probably just obfuscation for your example
I think what you actually want to do is this:
use strict;
use warnings 'all';
# ...
open my $fh, '<', $filename or die $!;
while ( my $line = <$fh> ) {
chomp $line;
my #fields = split( ',', $line );
my $site = $fields[0];
my $var1 = $fields[1];
my $var2 = $fields[4];
my $var3 = $fields[7];
open my $fh_out, '>', '/home/.../.../newfile.txt';
print $fh_out "$var1,$var2,$var3\n" if ( $var1 =~ "c01" && $var2 =~ "$newdate" );
close $fh_out;
}
close $fh;
You don't need the $abc variable in between at all. You can just print to your new file handle $fh_out that's open for writing.
Note that you will overwrite the newfile.txt file every time you have a match in a line inside $filename.
Your current code:
Prints the string
Assigns the result of printing it to a variable
Immediately overwrites that variable with a file handle (assuming open succeeded)
Closes that file handle without using it
Your logic should look more like this:
if ( $var1 =~ "c01" && $var2 =~ "$newdate" ) {
my $abc = "$var1,$var2,$var3\n"
open (my $file, '>', '/home/.../.../newfile.txt') || die("Could not open file: " . $!);
print $file $abc;
close $file;
}
You have a number of problems with your code. In addition to what others have mentioned
You create a new output file every time you find a matching input line. That will leave the file containing only the last printed string
Your test checks whether the text in the second column contains c01, but all of the lines in your sample input have control in the second column, so nothing will be printed
I'm guessing that you want to test for string equality, in which case you need eq instead of =~ which does a regular expression pattern match
I think it should look something more like this
use strict;
use warnings 'all';
use POSIX 'strftime';
my $currdate = uc strftime '%d%b%Y', localtime;
my ($input, $output) = qw/ data.txt newfile.txt /;
open my $fh, '<', $input or die qq{Unable to open "$input" for input: $!};
open my $out_fh, '>', $output or die qq{Unable to open "$output" for output: $!};
while ( <$fh> ) {
chomp;
my #fields = split /,/;
my ($site, $var1, $var2, $var3) = #fields[0,1,4,7];
next unless $var1 eq 'c01' and $var2 eq $currdate;
print $out_fh "$var1,$var2,$var3\n";
}
close $out_fh or die $!;
I want to add random string to existing identifier line in fasta file.
So I get:
MMETSP0259|AmphidiniumcarteCMP1314aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
Then the sequence on the next lines as normal. I am have problem with i think in the format output. This is what I get:
MMETSP0259|AmphidiniumCMP1314aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
CTTCATCGCACATGGATAACTGTGTACCTGACTaaaaaaaaaaaaaaaaaaaaaaaaaaaaaab
TCTGGGAAAGGTTGCTATCATGAGTCATAGAATaaaaaaaaaaaaaaaaaaaaaaaaaaaaaac
It's added to every line. (I altered length to fit here.) I want just to add to the identifier line.
This is what i have so far:
use strict;
use warnings;
my $currentId = "aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa";
my $header_line;
my $seq;
my $uniqueID;
open (my $fh,"$ARGV[0]") or die "Failed to open file: $!\n";
open (my $out_fh, ">$ARGV[0]_longer_ID_MMETSP.fasta");
while( <$fh> ){
if ($_ =~ m/^(\S+)\s+(.*)/) {
$header_line = $1;
$seq = $2;
$uniqueID = $currentId++;
print $out_fh "$header_line$uniqueID\n$seq";
} # if
} # while
close $fh;
close $out_fh;
Thanks very much, any ideas will be greatly appreciated.
Your program isn't working because the regex ^(\S+)\s+(.*) matches every line in the input file. For instance, \S+ matches CTTCATCGCACATGGATAACTGTGTACCTGACT; the newline at the end of the line matches \s+; and nothing matches .*.
Here's how I would encode your solution. It simply appends $current_id to the end of any line that contains a pipe | character
use strict;
use warnings;
use 5.010;
use autodie;
my ($filename) = #ARGV;
my $current_id = 'a' x 57;
open my $in_fh, '<', $filename;
open my $out_fh, '>', "${filename}_longer_ID_MMETSP.fasta";
while ( my $line = <$in_fh> ) {
chomp $line;
$line .= $current_id if $line =~ tr/|//;
print $line, "\n";
}
close $out_fh;
output
MMETSP0259|AmphidiniumCMP1314aaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaaa
CTTCATCGCACATGGATAACTGTGTACCTGACT
TCTGGGAAAGGTTGCTATCATGAGTCATAGAAT
I am trying to solve below issues.
I have 2 files. Address.txt and File.txt. I want to replace all A/B/C/D (File.txt) with corresponding string value (Read from Address.txt file) using perl script. It's not replacing in my output file. I am getting same content of File.txt.
I tried below codes.
Here is Address.txt file
A,APPLE
B,BAL
C,CAT
D,DOG
E,ELEPHANT
F,FROG
G,GOD
H,HORCE
Here is File.txt
A B C
X Y X
M N O
D E F
F G H
Here is my code :
use strict;
use warnings;
open (MYFILE, 'Address.txt');
foreach (<MYFILE>){
chomp;
my #data_new = split/,/sm;
open INPUTFILE, "<", $ARGV[0] or die $!;
open OUT, '>ariout.txt' or die $!;
my $src = $data_new[0];
my $des = $data_new[1];
while (<INPUTFILE>) {
# print "In while :$src \t$des\n";
$_ =~ s/$src/$des/g;
print OUT $_;
}
close INPUTFILE;
close OUT;
# /usr/bin/perl -p -i -e "s/A/APPLE/g" ARGV[0];
}
close (MYFILE);
If i Write $_ =~ s/A/Apple/g;
Then output file is fine and A is replacing with "Apple". But when dynamically coming it's not getting replaced.
Thanks in advance. I am new in perl scripting language . Correct me if I am wrong any where.
Update 1: I updated below code . It's working fine now. My questions Big O of this algo.
Code :
#!/usr/bin/perl
use warnings;
use strict;
open( my $out_fh, ">", "output.txt" ) || die "Can't open the output file for writing: $!";
open( my $address_fh, "<", "Address.txt" ) || die "Can't open the address file: $!";
my %lookup = map { chomp; split( /,/, $_, 2 ) } <$address_fh>;
open( my $file_fh, "<", "File1.txt" ) || die "Can't open the file.txt file: $!";
while (<$file_fh>) {
my #line = split;
for my $char ( #line ) {
( exists $lookup{$char} ) ? print $out_fh " $lookup{$char} " : print $out_fh " $char ";
}
print $out_fh "\n";
}
Not entirely sure how you want your output formatted. Do you want to keep the rows and columns as is?
I took a similar approach as above but kept the formatting the same as in your 'file.txt' file:
#!/usr/bin/perl
use warnings;
use strict;
open( my $out_fh, ">", "output.txt" ) || die "Can't open the output file for writing: $!";
open( my $address_fh, "<", "address.txt" ) || die "Can't open the address file: $!";
my %lookup = map { chomp; split( /,/, $_, 2 ) } <$address_fh>;
open( my $file_fh, "<", "file.txt" ) || die "Can't open the file.txt file: $!";
while (<$file_fh>) {
my #line = split;
for my $char ( #line ) {
( exists $lookup{$char} ) ? print $out_fh " $lookup{$char} " : print $out_fh " $char ";
}
print $out_fh "\n";
}
That will give you the output:
APPLE BAL CAT
X Y X
M N O
DOG ELEPHANT FROG
FROG GOD HORCE
Here's another option that lets Perl handle the opening and closing of files:
use strict;
use warnings;
my $addresses_txt = pop;
my %hash = map { $1 => $2 if /(.+?),(.+)/ } <>;
push #ARGV, $addresses_txt;
while (<>) {
my #array;
push #array, $hash{$_} // $_ for split;
print "#array\n";
}
Usage: perl File.txt Addresses.txt [>outFile.txt]
The last, optional parameter directs output to a file.
Output on your dataset:
APPLE BAL CAT
X Y X
M N O
DOG ELEPHANT FROG
FROG GOD HORCE
The name of the addresses' file is implicitly popped off of #ARGV for use later. Then, a hash is built, using the key/value pairs in File.txt.
The addresses' file is read, splitting each line into its single elements, and the defined-or (//) operator is used to returned the defined hash item or the single element, which is then pushed onto #array. Finally, the array is interpolated in a print statement.
Hope this helps!
First, here is your existing program, rewritten slightly
open the address file
convert the address file to a hash so that the letters are the keys and the strings the values
open the other file
read in the single line in it
split the line into single letters
use the letters to lookup in the hash
use strict;
use warnings;
open(my $a,"Address.txt")||die $!;
my %address=map {split(/,/) } map {split(' ')} <$a>;
open(my $f,"File.txt")||die $!;
my $list=<$f>;
for my $letter (split(' ',$list)) {
print $address{$letter}."\n" if (exists $address{$letter});
}
to make another file with the substitutions in place alter the loop that processes $list
for my $letter (split(' ',$list)) {
if (exists $address{$letter}) {
push #output, $address{$letter};
}
else {
push #output, $letter;
}
}
open(my $o,">newFile.txt")||die $!;
print $o "#output";
Your problem is that in every iteration of your foreach loop you overwrite any changes made earlier to output file.
My solution:
use strict;
use warnings;
open my $replacements, 'Address.txt' or die $!;
my %r;
foreach (<$replacements>) {
chomp;
my ($k, $v) = split/,/sm;
$r{$k} = $v;
}
my $re = '(' . join('|', keys %r) . ')';
open my $input, "<", $ARGV[0] or die $!;
while (<$input>) {
s/$re/$r{$1}/g;
print;
}
#!/usr/bin/perl -w
# to replace multiple text strings in a file with text from another file
#select text from 1st file, replace in 2nd file
$file1 = 'Address.txt'; $file2 = 'File.txt';
# save the strings by which to replace
%replacement = ();
open IN,"$file1" or die "cant open $file1\n";
while(<IN>)
{chomp $_;
#a = split ',',$_;
$replacement{$a[0]} = $a[1];}
close IN;
open OUT,">replaced_file";
open REPL,"$file2" or die "cant open $file2\n";
while(<REPL>)
{chomp $_;
#a = split ' ',$_; #replaced_data = ();
# replace strings wherever possible
foreach $i(#a)
{if(exists $replacement{$i}) {push #replaced_data,$replacement{$i};}
else {push #replaced_data,$i;}
}
print OUT trim(join " ",#replaced_data),"\n";
}
close REPL; close OUT;
########################################
sub trim
{
my $str = $_[0];
$str=~s/^\s*(.*)/$1/;
$str=~s/\s*$//;
return $str;
}
I want to extract the desired information from a file and append it into another. the first file consists of some lines as the header without a specific pattern and just ends with the "END OF HEADER" string. I wrote the following code for find the matching line for end of the header:
$find = "END OF HEADER";
open FILEHANDLE, $filename_path;
while (<FILEHANDLE>) {
my $line = $_;
if ($line =~ /$find/) {
#??? what shall I do here???
}
}
, but I don't know how can I get the rest of the file and append it to the other file.
Thank you for any help
I guess if the content of the file isn't enormous you can just load the whole file in a scalar and just split it with the "END OF HEADER" then print the output of the right side of the split in the new file (appending)
open READHANDLE, 'readfile.txt' or die $!;
my $content = do { local $/; <READHANDLE> };
close READHANDLE;
my (undef,$restcontent) = split(/END OF HEADER/,$content);
open WRITEHANDLE, '>>writefile.txt' or die $!;
print WRITEHANDLE $restcontent;
close WRITEHANDLE;
This code will take the filenames from the command line, print all files up to END OF HEADER from the first file, followed by all lines from the second file. Note that the output is sent to STDOUT so you will have to redirect the output, like this:
perl program.pl headfile.txt mainfile.txt > newfile.txt
Update Now modified to print all of the first file after the line END OF HEADER followed by all of the second file
use strict;
use warnings;
my ($header_file, $main_file) = #ARGV;
open my $fh, '<', $header_file or die $!;
my $print;
while (<$fh>) {
print if $print;
$print ||= /END OF HEADER/;
}
open $fh, '<', $main_file or die $!;
print while <$fh>;
use strict;
use warnings;
use File::Slurp;
my #lines = read_file('readfile.txt');
while ( my $line = shift #lines) {
next unless ($line =~ m/END OF HEADER/);
last;
}
append_file('writefile.txt', #lines);
I believe this will do what you need:
use strict;
use warnings;
my $find = 'END OF HEADER';
my $fileContents;
{
local $/;
open my $fh_read, '<', 'theFile.txt' or die $!;
$fileContents = <$fh_read>;
}
my ($restOfFile) = $fileContents =~ /$find(.+)/s;
open my $fh_write, '>>', 'theFileToAppend.txt' or die $!;
print $fh_write $restOfFile;
close $fh_write;
my $status = 0;
my $find = "END OF HEADER";
open my $fh_write, '>', $file_write
or die "Can't open file $file_write $!";
open my $fh_read, '<', $file_read
or die "Can't open file $file_read $!";
LINE:
while (my $line = <$fh_read>) {
if ($line =~ /$find/) {
$status = 1;
next LINE;
}
print $fh_write $line if $status;
}
close $fh_read;
close $fh_write;