This is a extract from my code :
foreach my $nouveau_code (#tableau_codes_utilises) {
my $code_found = 0;
foreach my $ligne_code_prospect (#tableau_liste_codes_prospects) {
//SOME CODE
}
print "HERE IS $nouveau_code\n";
if ( $code_found == 0 ) {
print "le code $nouveau_code n'a pas été trouvé\n";
STDOUT->autoflush;
}
}
And the result of an iteration where $code_found is equal to 0 is (code is hidden here, but is alphanumeric) :
HERE IS PAR****
n'a pas été trouvé
I do not understand why the second print (in the if sequence) does not print the whole line. I guess there is a buffering problem but I cannot find what is going on.
Any help would be appreciated.
At a guess, $nouveau_code has come from a file that originated on a Windows system and you are processing it on Linux?
If you use chomp in such a circumstance then it will remove the trailing newline, but not the carriage return, and printing the value will reset the screen cursor to the beginning of the line before printing anything else
The simple fix is to replace chomp with s/\R//, which will remove the CR as well as the LF on the end of the line
I suspect what is happening here is that your second data item contains backspaces (BS) or a carriage return (CR). So
your first item runs and prints out the first time, but since code_found=1 it doesn't go into the if.
your second item runs and the CR or BS in the data obscure the fact that the HERE IS was printed
your second item does not have a code found so the second print happens and the first part of it is overwritten by the same CR or BS sequence in your variable
The easy way to confirm this is to redirect your output and look at it like so:
script > check.log
vim check.log
and you should see the extra data in there. less would work fine in place of vim also.
Related
I have the following file:
#TWEETY:150:000000000-ACFKE:1:2104:27858:17965
AAATTAGCAAAAAACAATAACAAAACTGGGAAAATGCAATTTAACAACGAAAATTTTCCGAGAACTTGAAAGCGTACGAAAACGATACGCTCC
+
D1FFFB11FDG00EE0FFFA1110FAA1F/ABA0FGHEGDFEEFGDBGGGGFEHBFDDG/FE/EGH1#GF#F0AEEEEFHGGFEFFCEC/>EE
#TWEETY:150:000000000-ACFKE:1:1105:22044:20029
AAAAAATATTAAAACTACGAATGCATAAATTATTTCGTTCGAAATAAACTCACACTCGTAACATTGAACTACGCGCTCC
+
CCFDDDFGGGGGGGGGGHGGHHHHGHHHHHHHHHHHHHHHGHHGHHHHHHHHHHHHHGHGHGGHHHHHHGHHEGGGGGG
#TWEETY:150:000000000-ACFKE:1:2113:14793:7182
TATATAAAGCGAGAGTAGAAACTTTTTAATTGACGCGGCGAGAAAGTATATAGCAACAAGCGAGCACCCGCTCC
+
BBFFFFFGGGGFFGGFGHHHHHHHHHHHHHHHHHGGAEEEAFGGGHHFEGHHGHHHHHGHHGGGGFHHGG?EEG
#TWEETY:150:000000000-ACFKE:1:2109:5013:22093
AAAAAAATAATTCATATCGCCATATCGACTGACAGATAATCTATCTATAATCATAACTTTTCCCTCGCTCC
+
DAFAADDGF1EAGG3EG3A00ECGDFFAEGFCHHCAGHBGEAGBFDEDGGHBGHGFGHHFHHHBDG?/FA/
#TWEETY:150:000000000-ACFKE:1:2106:25318:19875
+
CCCCCCCCCCCCGGGGGGGGGGGGGGGGGGGGGGGGFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
The lines are in groups of four (each time there is a name, starting with #TWEETY, a string of letters, a + character, and another string of letters).
The second and fourth lines should have the same number of characters.
But there are cases where the second line is empty, as in the last four lines.
In these cases, I would like to get rid of the whole block (the previous line before the empty line and the next two lines).
I have just started perl and have been trying to write a script for my problem, but am having a hard time. Does anyone have some feedback?
Thanks!
Keep an array buffer of the last four lines. When it's full, check the second line, print the lines or not, empty the buffer, repeat.
#!/usr/bin/perl
use warnings;
use strict;
my #buffer;
sub output {
print #buffer unless 1 == length $buffer[1];
#buffer = ();
}
while (<>) {
if (4 == #buffer) {
output();
}
push #buffer, $_;
}
output(); # Don't forget to process the last four lines.
Yes. Start with looking at $/ and set it so you can work on a chunk at a time. I would suggest you can treat # as a record separator in your example.
Then iterate your records using a while loop. E.g. while ( <> ) {
Use split on \n to turn the current chunk into an array of lines.
Perform your test on the appropriate lines, and either print - or not - depending on whether it passed.
If you get stuck with that, then I'm sure a specific question including your code and where you're having problems will be well received here.
If you chunk the data correctly, this becomes almost trivial.
#!/usr/bin/perl
use strict;
use warnings;
# Use '#TWEETY' as the record separator to make it
# easy to chunk the data.
local $/ = '#TWEETY';
while (<DATA>) {
# The first entry will be empty (as the separator
# is the first thing in the file). Skip that record.
next unless /\S/;
# Skip any records with two consecutive newlines
# (as they will be the ones with the empty line 2)
next if /\n\n/;
# Print the remaining records
# (with $/ stuck back on the front)
print "$/$_";
}
__DATA__
#TWEETY:150:000000000-ACFKE:1:2104:27858:17965
AAATTAGCAAAAAACAATAACAAAACTGGGAAAATGCAATTTAACAACGAAAATTTTCCGAGAACTTGAAAGCGTACGAAAACGATACGCTCC
+
D1FFFB11FDG00EE0FFFA1110FAA1F/ABA0FGHEGDFEEFGDBGGGGFEHBFDDG/FE/EGH1#GF#F0AEEEEFHGGFEFFCEC/>EE
#TWEETY:150:000000000-ACFKE:1:1105:22044:20029
AAAAAATATTAAAACTACGAATGCATAAATTATTTCGTTCGAAATAAACTCACACTCGTAACATTGAACTACGCGCTCC
+
CCFDDDFGGGGGGGGGGHGGHHHHGHHHHHHHHHHHHHHHGHHGHHHHHHHHHHHHHGHGHGGHHHHHHGHHEGGGGGG
#TWEETY:150:000000000-ACFKE:1:2113:14793:7182
TATATAAAGCGAGAGTAGAAACTTTTTAATTGACGCGGCGAGAAAGTATATAGCAACAAGCGAGCACCCGCTCC
+
BBFFFFFGGGGFFGGFGHHHHHHHHHHHHHHHHHGGAEEEAFGGGHHFEGHHGHHHHHGHHGGGGFHHGG?EEG
#TWEETY:150:000000000-ACFKE:1:2109:5013:22093
AAAAAAATAATTCATATCGCCATATCGACTGACAGATAATCTATCTATAATCATAACTTTTCCCTCGCTCC
+
DAFAADDGF1EAGG3EG3A00ECGDFFAEGFCHHCAGHBGEAGBFDEDGGHBGHGFGHHFHHHBDG?/FA/
#TWEETY:150:000000000-ACFKE:1:2106:25318:19875
+
CCCCCCCCCCCCGGGGGGGGGGGGGGGGGGGGGGGGFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
Thanks everyone for the feedback!
It was all really useful. Thanks to your suggestions, I explored all the options and learned the unless statement.
The easiest solution given my existing code, was just to add an unless statement at the end.
### Write to output, but remove non-desired Gs
open OUT, ">$outfile";
my #accorder = #{$store0{"accorder"}};
foreach my $acc (#accorder){
# retrieve seq(2nd line) and qual(4th line)
my $seq = $store0{$acc}{"seq"};
my $qual = $store0{$acc}{"qual"};
# clean out polyG at end
$seq =~ s/G{3,}.{0,1}$//;
my $lenseq = length($seq);
my $lenqual = length($qual);
my $startqual = $lenqual - $lenseq;
$qual = substr($qual, 0, $lenseq);
#the above was in order to remove multiple G characters at the end of the
#second line, which is what led to empty lines (lines that were made up of
#only Gs got cut out)
# print to output, unless sequence has become empty
unless($lenseq == 0){ #this is the unless statement I added
print OUT "\#$acc\n$seq\n+\n$qual\n";
}
}
close(OUT);
I want to know that how to get the last printed text in QBasic.
Like if the program prints several lines, then how to get the last line printed.
Like this-
Print "aaaaaaa"
Print "bbbbbbb"
Then the program will get the last printed line i.e. bbbbbbb
Something like this maybe?
str$ = "aaaaaaa"
PRINT str$
str$ = "bbbbbbb"
PRINT str$
PRINT "last printed line:"; str$
Alternatively, as explained here, you can retrieve characters from screen memory by using PEEK at segment &HB800 , so something like this
DEF SEG = &HB800
mychar = PEEK(1) 'etc
You'd have to keep track of on which line was last printed to know where exactly you need to PEEK, so that will probably get very complicated very quickly...
For that reason I recommend you to rethink what it is exactly that you are trying to accomplish here because "screen scraping" like this is usually just a bad idea.
Given that last printed string did not end with semicolon, this code should do the trick:
FOR char.num = 1 TO 80
last.line$ = last.line$ + chr$(SCREEN(CSRLIN - 1, char.num))
NEXT char.num
PRINT "Content of last line printed to is:"; last.line$
Explanation: CSRLIN returns the current line of the cursor. SCREEN(y, x) returns the ascii-code of the character at y, x position (line, row) on the screen. Each time a string not ending with semicolon is printed to the screen, it is printed on the current line (y position) of the cursor, which is then incremented by one.
I realise this question already has an accepted answer but I have my own solution where instead of trying to work out what PRINT last PRINTed you instead use you own PRINT SUB in this example MYPRINT. While its not perfect and it only takes strings (hence STR$(123) and uses SHARED variables which are not necessarily advisable it is nicer than poking in the memory.
DECLARE SUB MYPRINT (text$)
DIM SHARED lastprint$
MYPRINT ("Hello, World!")
MYPRINT (STR$(123))
MYPRINT ("Hi Again")
MYPRINT (lastprint$)
SUB MYPRINT (text$)
PRINT (text$)
lastprint$ = text$
END SUB
The output:
Hello, World!
123
Hi Again
Hi Again
I'm trying to take a file INPUT and, if a line in that file contains a string, replace the line with something else (the entire line, including line breaks), or nothing at all (remove the line like it wasn't there). Writing all this to a new file .
Here's that section of code...
while(<INPUT>){
if ($_ =~ / <openTag>/){
chomp;
print OUTPUT "Some_Replacement_String";
} elsif ($_ =~ / <\/closeTag>/) {
chomp;
print OUTPUT ""; #remove the line
} else {
chomp;
print OUTPUT "$_\r\n"; #print the original line
}
}
while(<INPUT>) should read one line at a time (if my understanding is correct) and store each line in the special variable $_
However, when I run the above code I get only the very first if statement condition returned Some_Replacement_String, and only once. (1 line, out of a file with 1.3m, and expecting 600,000 replacements). This obviously isn't the behavior I expect. If I do something like while(<INPUT>){print OUTPUT $_;) I get a copy of the entire file, every line, so I know the entire file is being read (expected behavior).
What I'm trying to do is get a line, test it, do something with it, and move on to the next one.
If it helps with troubleshooting at all, if I use print $.; anywhere in that while statement (or after it), I get 1 returned. I expected this to be the "Current line number for the last filehandle accessed.". So by the time my while statement loops through the entire file, it should be equal to the number of lines in the file, not 1.
I've tried a few other variations of this code, but I think this is the closest I've come. I assume there's a good reason I'm not getting the behavior I expect, can anyone tell me what it is?
The problem you are describing indicates that your input file only contains one line. This may be because of a great many different things, such as:
You have changed the input record separator $/
Your input file does not contain the correct line endings
You are running your script with -0777 switch
Some notes on your code:
if ($_ =~ / <openTag>/){
chomp;
print OUTPUT "Some_Replacement_String";
No need to chomp a line you are not using.
} elsif ($_ =~ / <\/closeTag>/) {
chomp;
print OUTPUT "";
This is quite redundant. You don't need to print an empty string (ever, really), and chomp a value you're not using.
} else {
chomp;
print OUTPUT "$_\r\n"; #print the original line
No need to remove newlines and then put them back. Also, normally you would use \n as your line ending, even on windows.
And, since you are chomping in every if-else clause, you might as well move that outside the entire if-block.
chomp;
if (....) {
But since you are never relying on line endings not being there, why bother using chomp at all?
When using the $_ variable, you can abbreviate some commands, such as you are doing with chomp. For example, a lone regex will be applied to $_:
} elsif (/ <\/closeTag>/) { # works splendidly
When, like above, you have a regex that contains slashes, you can choose another delimiter for your regex, so that you do not need to escape the slashes:
} elsif (m# </closeTag>#) {
But then you need to use the full notation of the m// operator, with the m in front.
So, in short
while(<INPUT>){
if (/ <openTag>/){
print OUTPUT "Some_Replacement_String";
} elsif (m# </closeTag>#) {
# do nothing
} else {
print OUTPUT $_; # print the original line
}
}
And of course, the last two can be combined into one, with some negation logic:
} elsif (not m# </closeTag>#) {
print OUTPUT $_;
}
I am making a concatenating do-while loop wherein each of the entered strings will be added to the main string $food. Here is the code:
do {
print("\nEnter your order(-1 to end): ");
$order = <>;
chop($order);
if ($order != -1) {
$food .= " ".$order;
print($food);
}
} while ( $order != -1)
print ($food); #PROBLEM HERE!
The problem is that whenever I put print ($food) outside the loop, a syntax error for this line appears plus an Execution of file.pl aborted due to compilation errors message.
The code works once I put print ($food) inside the loop but I am curious to why this error is happening.
Your line before last print has syntax error - it does not end with ;.
Just add it and it should work.
A thing worth mentioning in addition to the syntax error: I see that you you start the string with a newline. While this is fine, it might be considered "better" to end strings with the newline before printing, as printing a newline would result in flushing the STDOUT buffer right away. In most cases, this is the behavior you want, as it prevents delayed output and text flickering (especially if printing a lot).
My program (which happens to be in Perl, though I don't think this question is Perl-specific) outputs status messages at one point in the program of the form Progress: x/yy where x and yy are a number, like: Progress: 4/38.
I'd like to "overwrite" the previous output when a new status message is printed so I don't fill the screen with status messages. So far, I've tried this:
my $progressString = "Progress\t$counter / " . $total . "\n";
print $progressString;
#do lots of processing, update $counter
my $i = 0;
while ($i < length($progressString)) {
print "\b";
++$i;
}
The backspace character won't print if I include a newline in $progressString. If I leave out the newline, however, the output buffer is never flushed and nothing prints.
What's a good solution for this?
Use autoflush with STDOUT:
local $| = 1; # Or use IO::Handle; STDOUT->autoflush;
print 'Progress: ';
my $progressString;
while ...
{
# remove prev progress
print "\b" x length($progressString) if defined $progressString;
# do lots of processing, update $counter
$progressString = "$counter / $total"; # No more newline
print $progressString; # Will print, because auto-flush is on
# end of processing
}
print "\n"; # Don't forget the trailing newline
Say
$| = 1
somewhere early in your program to turn autoflushing on for the output buffer.
Also consider using "\r" to move the cursor back to the beginning of the line, rather than trying to explicitly count how many spaces you need to move back.
Like you said, don't print out a newline while your progress counter is running or else you will print out your progress on a separate line instead of overwriting the old line.
I know it's not quite what you asked for, but possibly better. I happened on this same problem and so rather than deal with it too much went to using Term::ProgressBar which looks nice too.
You can also use the ANSI escape codes to directly control the cursor. Or you can use Term::ReadKey to do the same thing.
I had to tackle something similar to this today.
If you don't mind reprinting the entire line, you could do something like this:
print "\n";
while (...) {
print "\rProgress: $counter / $total";
# do processing work here
$counter++;
}
print "\n";
The "\r" character is a carriage return-- it brings the cursor back to the beginning of the line. That way, anything you print out overwrites the previous progress notification's text.