delete previous and next lines in perl - perl

Question

I have the following file:
#TWEETY:150:000000000-ACFKE:1:2104:27858:17965
AAATTAGCAAAAAACAATAACAAAACTGGGAAAATGCAATTTAACAACGAAAATTTTCCGAGAACTTGAAAGCGTACGAAAACGATACGCTCC
+
D1FFFB11FDG00EE0FFFA1110FAA1F/ABA0FGHEGDFEEFGDBGGGGFEHBFDDG/FE/EGH1#GF#F0AEEEEFHGGFEFFCEC/>EE
#TWEETY:150:000000000-ACFKE:1:1105:22044:20029
AAAAAATATTAAAACTACGAATGCATAAATTATTTCGTTCGAAATAAACTCACACTCGTAACATTGAACTACGCGCTCC
+
CCFDDDFGGGGGGGGGGHGGHHHHGHHHHHHHHHHHHHHHGHHGHHHHHHHHHHHHHGHGHGGHHHHHHGHHEGGGGGG
#TWEETY:150:000000000-ACFKE:1:2113:14793:7182
TATATAAAGCGAGAGTAGAAACTTTTTAATTGACGCGGCGAGAAAGTATATAGCAACAAGCGAGCACCCGCTCC
+
BBFFFFFGGGGFFGGFGHHHHHHHHHHHHHHHHHGGAEEEAFGGGHHFEGHHGHHHHHGHHGGGGFHHGG?EEG
#TWEETY:150:000000000-ACFKE:1:2109:5013:22093
AAAAAAATAATTCATATCGCCATATCGACTGACAGATAATCTATCTATAATCATAACTTTTCCCTCGCTCC
+
DAFAADDGF1EAGG3EG3A00ECGDFFAEGFCHHCAGHBGEAGBFDEDGGHBGHGFGHHFHHHBDG?/FA/
#TWEETY:150:000000000-ACFKE:1:2106:25318:19875
+
CCCCCCCCCCCCGGGGGGGGGGGGGGGGGGGGGGGGFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF
The lines are in groups of four (each time there is a name, starting with #TWEETY, a string of letters, a + character, and another string of letters).
The second and fourth lines should have the same number of characters.
But there are cases where the second line is empty, as in the last four lines.
In these cases, I would like to get rid of the whole block (the previous line before the empty line and the next two lines).
I have just started perl and have been trying to write a script for my problem, but am having a hard time. Does anyone have some feedback?
Thanks!

Answer 1

Keep an array buffer of the last four lines. When it's full, check the second line, print the lines or not, empty the buffer, repeat.
#!/usr/bin/perl
use warnings;
use strict;
my #buffer;
sub output {
print #buffer unless 1 == length $buffer[1];
#buffer = ();
}
while (<>) {
if (4 == #buffer) {
output();
}
push #buffer, $_;
}
output(); # Don't forget to process the last four lines.

Answer 2

Yes. Start with looking at $/ and set it so you can work on a chunk at a time. I would suggest you can treat # as a record separator in your example.
Then iterate your records using a while loop. E.g. while ( <> ) {
Use split on \n to turn the current chunk into an array of lines.
Perform your test on the appropriate lines, and either print - or not - depending on whether it passed.
If you get stuck with that, then I'm sure a specific question including your code and where you're having problems will be well received here.

Answer 3

If you chunk the data correctly, this becomes almost trivial.
#!/usr/bin/perl
use strict;
use warnings;
# Use '#TWEETY' as the record separator to make it
# easy to chunk the data.
local $/ = '#TWEETY';
while (<DATA>) {
# The first entry will be empty (as the separator
# is the first thing in the file). Skip that record.
next unless /\S/;
# Skip any records with two consecutive newlines
# (as they will be the ones with the empty line 2)
next if /\n\n/;
# Print the remaining records
# (with $/ stuck back on the front)
print "$/$_";
}
__DATA__
#TWEETY:150:000000000-ACFKE:1:2104:27858:17965
AAATTAGCAAAAAACAATAACAAAACTGGGAAAATGCAATTTAACAACGAAAATTTTCCGAGAACTTGAAAGCGTACGAAAACGATACGCTCC
+
D1FFFB11FDG00EE0FFFA1110FAA1F/ABA0FGHEGDFEEFGDBGGGGFEHBFDDG/FE/EGH1#GF#F0AEEEEFHGGFEFFCEC/>EE
#TWEETY:150:000000000-ACFKE:1:1105:22044:20029
AAAAAATATTAAAACTACGAATGCATAAATTATTTCGTTCGAAATAAACTCACACTCGTAACATTGAACTACGCGCTCC
+
CCFDDDFGGGGGGGGGGHGGHHHHGHHHHHHHHHHHHHHHGHHGHHHHHHHHHHHHHGHGHGGHHHHHHGHHEGGGGGG
#TWEETY:150:000000000-ACFKE:1:2113:14793:7182
TATATAAAGCGAGAGTAGAAACTTTTTAATTGACGCGGCGAGAAAGTATATAGCAACAAGCGAGCACCCGCTCC
+
BBFFFFFGGGGFFGGFGHHHHHHHHHHHHHHHHHGGAEEEAFGGGHHFEGHHGHHHHHGHHGGGGFHHGG?EEG
#TWEETY:150:000000000-ACFKE:1:2109:5013:22093
AAAAAAATAATTCATATCGCCATATCGACTGACAGATAATCTATCTATAATCATAACTTTTCCCTCGCTCC
+
DAFAADDGF1EAGG3EG3A00ECGDFFAEGFCHHCAGHBGEAGBFDEDGGHBGHGFGHHFHHHBDG?/FA/
#TWEETY:150:000000000-ACFKE:1:2106:25318:19875
+
CCCCCCCCCCCCGGGGGGGGGGGGGGGGGGGGGGGGFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF

Answer 4

Thanks everyone for the feedback!
It was all really useful. Thanks to your suggestions, I explored all the options and learned the unless statement.
The easiest solution given my existing code, was just to add an unless statement at the end.
### Write to output, but remove non-desired Gs
open OUT, ">$outfile";
my #accorder = #{$store0{"accorder"}};
foreach my $acc (#accorder){
# retrieve seq(2nd line) and qual(4th line)
my $seq = $store0{$acc}{"seq"};
my $qual = $store0{$acc}{"qual"};
# clean out polyG at end
$seq =~ s/G{3,}.{0,1}$//;
my $lenseq = length($seq);
my $lenqual = length($qual);
my $startqual = $lenqual - $lenseq;
$qual = substr($qual, 0, $lenseq);
#the above was in order to remove multiple G characters at the end of the
#second line, which is what led to empty lines (lines that were made up of
#only Gs got cut out)
# print to output, unless sequence has become empty
unless($lenseq == 0){ #this is the unless statement I added
print OUT "\#$acc\n$seq\n+\n$qual\n";
}
}
close(OUT);