i want to define something similar to a computation method:
NSString *format = #"%d + 1";
In my code i want to do something like:
int computedNumber = sum(format,5) => the result should be 6.
could you give some suggestions?
thank you
EDIT:
or something similar to:
NSNumber *no = [NSNumber numberWithFormat:format,5];
It is not normally possible, however there have been written parsers for this specific tasks, to mention DDMathParser by SO user Dave DeLong.
But for what task do you really need this? You have the + operator, and then you perform the sum function? Couldn't you simply parse the number at the end of the format, then perform the operation you'd like?
Using Macro can be an alternative solution to your problem. You can define a macro like the following,
#define INC(a) (a + 1)
Here, INC and a are user-defined. You can give them any name you want. Compiler will substitute (a + 1) in your code, where ever you call INC(a). For example, consider the following,
int computedNumber = INC(5);
After the compilation the code will be,
int computedNumber = (5 + 1); // the result during the execution is 6.
Related
I am looking for some style/best practice advice. I often find myself writing scripts which need many (several tens of) parameters to be defined at the beginning. Then these parameters are used by many functions within the script. A minimum, simplified example might look something like the following:
params.var1 = 1;
params.var2 = 10;
params.var3 = 100;
params.var4 = 1e3;
result1 = my_func1(params);
result2 = my_func2(params);
Now, I don't want to pass many inputs into every function, so am reluctant to do something like result1 = my_func1(var1,var2,var3,var4,...). Therefore, I always find myself making each variable a field of a structure (e.g. params), and then passing this structure alone into each function, as above. The structure is not modified by the functions, only the parameters are used for further calculations.
One of the functions might look like this then:
function result = my_func1(params)
var1 = params.var1;
var2 = params.var2;
var3 = params.var3;
var4 = params.var4;
result = var1.^2 + var2.^2 -var3.^3 + var4;
end
Now, because I don't want to refer to each variable within the function as params.var1, etc. (in the interest of keeping the expression for result as clear as possible), I first do all this unpacking at the beginning using var1 = params.var1.
I suppose the best thing to be doing in situations like this might be to use classes (because I have some data and also want to perform functions on that data). Are there any better ways for me to be doing this kind of thing without moving fully to object-oriented code?
I would simply leave the unpacking out. Call the struct params something shorter inside the function, to keep clutter to a minimum:
function result = my_func1(p)
result = p.var1.^2 + p.var2.^2 - p.var3.^3 + p.var4;
end
I would keep calling it params elsewhere, so you don’t have to deal with cryptic names.
You can define constant functions:
function out = var1
out = 1;
end
function out = var2
out = 10;
end
function result = my_func1
result = var1.^2 + var2.^2;
end
Based on your actual application you may pass array of numbers:
var = [var1 var2 var3 var4];
my_func1(var);
my_func1(var1,var2,var3,var4,...) in my opinion is preferred over passing struct.
I have a function with the form:
function t = fun(str1, str2, str3)
I'm trying to figure out a way to have the arguments passed to it as one cell containing the 3 arguments. Is there a way to do this? i.e.:
args = {str1, str2, str3};
x = fun(args);
I'm trying to find something that sets up this type of functionality. I know I could theoretically do fun(args{1}, args{2}, args{3}) but this isn't quite what I had in mind. I know varargs would work, but only if I were to change the function inputs, which I hope not to have to do. Anyway, thanks for the help.
How about
args = {str1, str2, str3};
x = fun(args{:});
I know the question seems a bit heretical. Indeed, having much appreciated lambdas in C++11, I was quite thrilled to learn a language which was built to support them from the beginning rather than as a contrived addition.
However, I cannot figure out how to do with Scala all I can do with C++11 lambdas.
Suppose I want to make a function which adds to a number passed as a parameter some value contained in a variable a. In C++, I can do both
int a = 5;
auto lambdaVal = [ a](int par) { return par + a; };
auto lambdaRef = [&a](int par) { return par + a; };
Now, if I change a, the second version will change its behavior; but the first will keep adding 5.
In Scala, if I do this
var a = 5
val lambdaOnly = (par:Int) => par + a
I essentially get the lambdaRef model: changing a will immediately change what the function does.
(which seems somewhat specious to me given that this time a isn't even mentioned in the declaration of the lambda, only in its code. But let it be)
Am I missing the way to obtain lambdaVal? Or do I have to first copy a to a val to be free to modify it afterwards without side effects?
The a in the function definition refers the variable a. If you want to use the current value of a when the lambda has been created, you have to copy the value like this:
val lambdaConst = {
val aNow = a
(par:Int) => par + aNow
}
I want to create a CoffeeScript range (like [4...496]) but using a length instead of an end range. This can be done with a loop like
myNum = getBigNumber()
newArray = ( n + myNum for n in [0...50] )
but I'm wondering if there is range-related shortcut that I'm missing. Is there something like
[getBigNumber()...].length(50) available in CoffeeScript?
You can just do
range = [myNum...myNum + 50]
Edit: As mu points out in the comments, CoffeeScript will add some complexity whether you use the snippet above or the original code. If performance is an issue, it might be better to drop down to plain JS for the loop (using backticks in the CoffeeScript code).
Assuming you want an ascending (i.e. low to high) range, you can do:
myNum = getBigNumber()
length = 50
range = new Array length
i = 0
`for(; i < length ; i++) { range[i] = i + myNum }` # raw, escaped JS
It's a lot faster than CoffeeScript's way of doing things, but note that CoffeeScript's range syntax also supports creating descending ranges by just flipping the boundary values. So CoffeeScript is (as always) easier on the eyes and simpler to work with, but raw JS is 3.5x faster in my test.
The function arithenco needs the input message to be a sequence of positive integers. Hence, I need convert a message into a sequence of numbers message_int, by using the following mapping.
‘A’→1, ‘C’→2, ‘G’→3, ‘T’→4.
From what I understand, the alphabet you are using contains only four values A,C,G,T (DNA sequences I suppose).
Simple comparison would suffice:
seq = 'TGGAGGCCCACAACCATTCCCTCAGCCCAATTGACCGAAAGGGCGCGA';
msg_int = zeros(size(seq));
msg_int(seq=='A') = 1;
msg_int(seq=='C') = 2;
msg_int(seq=='G') = 3;
msg_int(seq=='T') = 4;
Oh, just reread your question: your mapping is not so simple. Sorry.
(since darvidsOn wrote the same I won't delete this answer - it might give you a start - but it doesn't answer your question completely).
Have a look at http://www.matrixlab-examples.com/ascii-chart.html
You can use d = double('A') to convert a char into a double- you will then need to subtract 64 to get the mapping that you want (because A is ascii code 65).