I'm running a large Hadoop streaming job where I process a large list of files with each file being processed as a single unit. To do this, my input to my streaming job is a single file with a list of all the file names on separate lines.
In general, this works well. However, I ran into an issue where I was partially through a large job (~36%) when Hadoop ran into some files with issues and for some reason it seemed to crash the entire job. If the job had completed successfully, what would have been printed to standard out would be a line for each file as it was completed along with some stats from my program that's processing each file. However, with this failed job, when I try to look at the output that would have been sent to standard out, it is empty. I know that roughly 36% of the files were processed (because I'm saving the data to a database), but it's not easy for me to generate a list of which files were successfully processed and which ones remain. Is there anyway to recover this logging to standard out?
One thing I can do is look at all of the log files for the completed/failed tasks, but this seems more difficult to me and I'm not sure how to go about retrieving the good/bad list of files this way.
Thanks for any suggestions.
Hadoop captures system.out data here :
/mnt/hadoop/logs/userlogs/task_id
However, I've found this unreliable, and Hadoop jobs dont usually use standard out for debugging, rather - the convetion is to use counters.
For each of your documents, you can summarize document characteristics : like length, number of normal ascii chars, number of new lines.
Then, you can have 2 counters: a counter for "good" files, and a counter for "bad" files.
It probably be pretty easy to note that the bad files have something in common [no data, too much data, or maybe some non printable chars].
Finally, you obviously will have to look at the results after the job is done running.
The problem, of course, with system.out statements is that the jobs running on various machines can't integrate their data. Counters get around this problem - they are easily integrated into a clear and accurate picture of the overall job.
Of course, the problem with counters is the information content is entirely numeric, but, with a little creativity, you can easily find ways to quantitatively describe the data in a meaningfull way.
WORST CASE SCENARIO : YOU REALLY NEED TEXT DEBUGGING, and you dont want it in a temp file
In this case, you can use MultipleOutputs to write out ancillary files with other data in them. You can emit records to these files in the same way as you would for the part-r-0000* data.
In the end, I think you will find that, ironically, the restriction of having to use counters will increase the readability of your jobs : it is pretty intuitive, once you think about it, to debug using numerical counts rather than raw text --- i find, quite often that much of my debugging print statements are, when cut down to their raw information content, are basically just counters...
Related
During my cloud dataprep adventures I have come across yet another very annoying bug.
The problem occurs when creating complex flow structures which need to be connected through reference datasets. If a certain limit is crossed in performing a number of unions or a joins with these sets, dataflow is unable to start a job.
I have had a lot of contact with support and they are working on the issue:
"Our Systems Engineer Team was able to determine the root cause resulting into the failed job. They mentioned that the job is too large. That means that the recipe (combined from all datasets) is too big, and Dataflow rejects it. Our engineering team is still investigating approaches to address this.
A workaround is to split the job into two smaller jobs. The first run the flow for the data enrichment, and then use the output as input in the other flow. While it is not ideal, this would be a working solution for the time being."
I ran into the same problem and have a fairly educated guess as to the answer. Keep in mind that DataPrep simply takes all your GUI based inputs and translates it into Apache Beam code. When you pass in a reference data set, it probably writes some AB code that turns the reference data set into a side-input (https://beam.apache.org/documentation/programming-guide/). DataFlow will perform a Parellel Do (ParDo) function where it takes each element from a PCollection, stuffs it into a worker node, and then applies the side-input data for transformation.
So I am pretty sure if the reference sets get too big (which can happen with Joins), the underlying code will take an element from dataset A, pass it to a function with side-input B...but if side-input B is very big, it won't be able to fit into the worker memory. Take a look at the Stackdriver logs for your job to investigate if this is the case. If you see 'GC (Allocation Failure)' in your logs this is a sign of not enough memory.
You can try doing this: suppose you have two CSV files to read in and process, file A is 4 GB and file B is also 4 GB. If you kick off a job to perform some type of Join, it will very quickly outgrow the worker memory and puke. If you CAN, see if you can pre-process in a way where one of the files is in the MB range and just grow the other file.
If your data structures don't lend themselves to that option, you could do what the Sys Engs suggested, split one file up into many small chunks and then feed it to the recipe iteratively against the other larger file.
Another option to test is specifying the compute type for the workers. You can iteratively grow the compute type larger and larger to see if it finally pushes through.
The other option is to code it all up yourself in Apache Beam, test locally, then port to Google Cloud DataFlow.
Hopefully these guys fix the problem soon, they don't make it easy to ask them questions, that's for sure.
I'm trying to figure out how to use Apache Beam to read large CSV files. By "large" I mean, several gigabytes (so that it would be impractical to read the entire CSV into memory at once).
So far, I've tried the following options:
Use TextIO.read(): this is no good because a quoted CSV field could contain a newline. In addition, this tries to read the entire file into memory at once.
Write a DoFn that reads the file as a stream and emits records (e.g. with commons-csv). However, this still reads the entire file all at once.
Try a SplittableDoFn as described here. My goal with this is to have it gradually emit records as an Unbounded PCollection - basically, to turn my file into a stream of records. However, (1) it's hard to get the counting right (2) it requires some hacky synchronizing since ParDo creates multiple threads, and (3) my resulting PCollection still isn't unbounded.
Try to create my own UnboundedSource. This seems to be ultra-complicated and poorly documented (unless I'm missing something?).
Does Beam provide anything simple to allow me to parse a file the way I want, and not have to read the entire file into memory before moving on to the next transform?
The TextIO should be doing the right thing from Beam's prospective, which is reading in the text file as fast as possible and emitting events to the next stage.
I'm guessing you are using the DirectRunner for this, which is why you are seeing a large memory footprint. Hopefully this isn't too much explanation: The DirectRunner is a test runner for small jobs and so it buffers intermediate steps in memory rather then to disk. If you are still testing your pipeline, you should use a small sample of your data until you think it is working. Then you can use the Apache Flink runner or Google Cloud Dataflow runner which will both write intermediate stages to disk when needed.
In general, splitting csv files with quoted newlines is hard as it may require arbitrary look-back to determine whether a given newline is or is not in a quoted segment. If you can arrange such that the CSV has no quoted newlines, TextIO.read() works well. Otherwise
If you're using BeamPython, consider the dataframe operation apache_beam.dataframe.io.read_csv which will handle quotation correctly (and efficiently).
In another language, you can either use that as a cross-language transform, or create a PCollection of file paths (e.g. via FileIO.MatchAll) followed by a DoFn that reads and emits rows incrementally using your CSV library of choice. With the exception of a direct/local runner, this should not require reading the entire file into memory (though it will cause each individual file to be read by a single worker, possibly limiting parallelism).
You can use the logic in Text to Cloud Spanner for handling new lines while reading a CSV.
This template reads data from a CSV and writes to Cloud Spanner.
The specific files containing the logic to read CSV with newlines are in ReadFileShardFn and SplitIntoRangesFn.
My application produces rotating log files containing multiple application metrics. The log file is rotated once a minute, but each file is still relatively large (over 30MB, with 100ks of rows)
I'd like to feed the logs into PipelineDB (running on the same single machine) which Countiuous View can create for me exactly the aggregations I need over the metrics.
I can easily ship the logs to PipelineDB using copy from stdin, which works great.
However, a machine might occasionally power off unexpectedly (e.g. due to power shortage) during the copy of a log file. Which means that once back online there is uncertainty how much of the file has been inserted into PipelineDB.
How could I ensure that each row in my logs is inserted exactly once in such cases? (It's very important that I get complete and accurate aggregations)
Notice each row in the log file has a unique identifier (serial number created by my application), but I can't find in the docs the option to define a unique field in the stream. I assume that PipelineDB's design is not meant to handle unique fields in stream rows
Nonetheless, are there any alternative solutions to this issue?
Exactly once semantics in a streaming (infinite rows) context is a very complex problem. Most large PipelineDB deployments use some kind of message bus infrastructure (e.g. Kafka) in front of PipelineDB for delivery semantics and reliability, as that's not PipelineDB's core focus.
That being said, there are a couple of approaches you could use here that may be worth thinking about.
First, you could maintain a regular table in PipelineDB that keeps track of each logfile and the line number that it has successfully written to PipelineDB. When beginning to ship a new logfile, check it against this table to determine which line number to start at.
Secondly, you could separate your aggregations by logfile (by including a path or something in the grouping) and simply DELETE any existing rows for that logfile before sending it. Then use combine to aggregate over all logfiles at read time, possibly with a VIEW.
I am trying to run a Spark job over data from multiple Cassandra tables which are grouped as part of the job. I am trying to get an end to end run with a huge data set 13m data points and it has failed over multiple points. As I fix those failures and move ahead, I encounter the next problem which I fix and restart the job again. Is there a way to speed up the testing cycle on real data so that I can restart/resume a previously failed job from a specific checkpoint?
You can checkpoint your RDDs to disk at various midpoints, which would let you restart from there if necessary. You would have to save the intermediates as a sequence file or text file, and do a little work to make sure everything goes to and from disk cleanly.
I find it more useful to start up the spark-shell and build my data flow in there. If you can identify a subset of your data which is representative, even better. Once you get into the REPL you can create RDDs, check the first value or take(100) and print them to stdout, count various result data sets, and so on. The REPL is what makes spark 10x more productive than hadoop for me.
Once I have built, in the REPL, a flow of transformations and actions that gets me the result that I need, then I can form it into a scala file and refactor that to be clean; extract functions that can be reused and unit tested, tune the parallelism, whatever.
I often find myself going back into the REPL when I need to extend my data flow, so I copy and paste code from my scala file to get to a good starting point, and experiment with the extension from there.
I have some very weird data corruption trouble recently.
Basically what I do is:
transfer some large data (50files, each around 8GB) from one server to hpcc(high performance computing) using "scp"
Process each line of input files, and then append/write those modified lines to output files. And I do this on hpcc by "qsub -t 1-1000 xxx.sh", that is throwing out all 1000 jobs at the same time. Also these 1000 jobs are on average using 4GB of memory each.
The basic format of my script is:
f=open(file)
for line in f:
#process lines
or
f=open(file).readlines()
#process lines
However, weird part is: from time to time, I can see data corruption in some parts of my data.
First, I just find some of my "input" data is corrupted (not ALL); then I just doubt if it's the problem of "scp". I ask some computer guys, and also post here, but seems there's very little possibility that 'scp' can distort the data.
And I just do "scp" to transfer my data again to hpcc; and the input data this time becomes ok. weird, right?
So this propels me to think: is it possible that input data maybe disrupted by being used to run memory/CPU usage-intensive programs?
If input data is corrupted, it's very natural that output is also corrupted. Ok, then I transfer the input data again to hpcc, and check that all of them are in good-shape, I then run programs (should point out:run 1000 jobs together), and the output files...most of them are good; however very surprisingly, some portion of only one file are corrupted! So for I just singly run program for this specific file again, then get good output without any corruption!!
I'm so confused......After seeing so many weird things, my only conclusion is: maybe running many memory-intensive jobs at the same time will harm the data? (But I used to also run lots of such jobs, and seems ok)
And by data corruption, I mean:
Something like this:
CTTGTTACCCAGTTCCAAAG9583gfg1131CCGGATGCTGAATGGCACGTTTACAATCCTTTAGCTAGACACAAAAGTTCTCCAAGTCCCCACCAGATTAGCTAGACACAGAGGGCTGGTTGGTGCATCT0/1
gfgggfgggggggggggggg9583gfg1131CCGGAfffffffaedeffdfffeffff`fffffffffcafffeedffbfbb[aUdb\``ce]aafeeee\_dcdcWe[eeffd\ebaM_cYKU]\a\Wcc0/1
CTTGTTACCCAGTTCCAAAG9667gfg1137CCGGATCTTAAAACCATGCTGAGGGTTACAAA1AGAAAGTTAACGGGATGCTGATGTGGACTGTGCAAATCGTTAACATACTGAAAACCTCT0/1
gfgggfgggggggggggggg9667gfg1137CCGGAeeeeeeeaeeb`ed`dadddeebeeedY_dSeeecee_eaeaeeeeeZeedceadeeXbd`RcJdcbc^c^e`cQ]a_]Z_Z^ZZT^0/1
However it should be like:
#HWI-ST150_0140:6:2204:16666:85719#0/1
TGGGCTAAAAGGATAAGGGAGGGTGAAGAGAGGATCTGGGTGAACACACAAGAGGCTTAAAGCATTTTATCAAATCCCAATTCTGTTTACTAGCTGTGTGA
+HWI-ST150_0140:6:2204:16666:85719#0/1
gggggggggggggggggfgggggZgeffffgggeeggegg^ggegeggggaeededecegffbYdeedffgggdedffc_ffcffeedeffccdffafdfe
#HWI-ST150_0140:6:2204:16743:85724#0/1
GCCCCCAGCACAAAGCCTGAGCTCAGGGGTCTAGGAGTAGGATGGGTGGTCTCAGATTCCCCATGACCCTGGAGCTCAGAACCAATTCTTTGCTTTTCTGT
+HWI-ST150_0140:6:2204:16743:85724#0/1
ffgggggggfgeggfefggeegfggggggeffefeegcgggeeeeebddZggeeeaeed[ffe^eTaedddc^Oacccccggge\edde_abcaMcccbaf
#HWI-ST150_0140:6:2204:16627:85726#0/1
CCCCCATAGTAGATGGGCTGGGAGCAGTAGGGCCACATGTAGGGACACTCAGTCAGATCTATGTAGCTGGGGCTCAAACTGAAATAAAGAATACAGTGGTA