This program doesn't print that the strings are equal but when they get printed, they appear to be the same...someone please explain
#!/usr/bin/perl
$str = "print \"I want this to work\\n\";";
print $str."\n";
open FILE, "<", "check2.doc" or die "buhuhuhu";
my $str2;
while (<FILE>) {
$str2 = $_;
}
close FILE;
print "$str2\n";
if ( $str eq $str2) {
print "they are equal\n";
But when the output comes there is this extra line at the bottom due to the second string $str2
print "I want this to work\n";
print "I want this to work\n";
-----empty line-----
Here is the file check2.doc
print "I want this to work\n";
Does anyone know why they are not equal???
The file read includes the \n, so you have to remove it:
$str2 = $_;
chomp $str2;
And, if your file has only one line, replace the while loop by:
$str2 = <FILE>;
chomp $str2;
The line in the file is created by
$str."\n"
Of course that's not equal to
$str
You need to remove the trailing newline.
my $str2 = <FILE>;
chomp($str2);
Related
I am trying to convert a string into an array based on space delimiter.
My input file looks like this:
>Reference
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnctcACCATGGTGTCGACTC
TTCTATGGAAACAGCGTGGATGGCGTCTCCAGGCGATCTGACGGTTCACTAAACGAGCTC
Ignoring the line starting with >, the length of rest of the string is 360.
I am trying to convert this into an array.
Here's my code so far:
#!/usr/bin/perl
use strict;
use warnings;
#### To to change bases with less than 10X coverage to N #####
#### Take depth file and consensus fasta file as input arguments ####
my ($in2) = #ARGV;
my $args = $#ARGV + 1;
if ( $args != 1 ) {
print "Error!!! Insufficient Number of Argumrnts\n";
print "Usage: $0 <consensus fasta file> \n";
}
#### Open a filehandle to read in consensus fasta file ####
my $FH2;
my $line;
my #consensus;
my $char;
open($FH2, '<', $in2) || die "Could not open file $in2\n";
while ( <$FH2> ) {
$line = $_;
chomp $line;
next if $line =~ />/; # skip header line
$line =~ s/\s+//g;
my $len = length($line);
print "$len\n";
#print "$line";
#consensus = split(// , $line);
print "$#consensus\n";
#print "#consensus\n";
#for $char (0 .. $#consensus){
# print "$char: $consensus[$char]\n";
# }
}
The problem is the $len variable returns a value of 60 instead of 360 and $#consensus returns a value of 59 instead of 360 which is the length of the string.
I have removed the whitespace after each line with code $line =~ s/\s+//g;but it still is not working.
It looks like your code is essentially working. It's just your checking logic that makes no sense. I'd do the following:
use strict;
use warnings;
if (#ARGV != 1) {
print STDERR "Usage: $0 <consensus fasta file>\n";
exit 1;
}
open my $fh, '<', $ARGV[0] or die "$0: cannot open $ARGV[0]: $!\n";
my #consensus;
while (my $line = readline $fh) {
next if $line =~ /^>/;
$line =~ s/\s+//g;
push #consensus, split //, $line;
}
print "N = ", scalar #consensus, "\n";
Main things to note:
Error messages should go to STDERR, not STDOUT.
If an error occurs, the program should exit with an error code, not keep running.
Error messages should include the name of the program and the reason for the error.
chomp is redundant if you're going to remove all whitespace anyway.
As you're processing the input line by line, you can just keep pushing elements to the end of #consensus. At the end of the loop it'll have accumulated all characters across all lines.
Examining #consensus within the loop makes little sense as it hasn't finished building yet. Only after the loop do we have all characters we're interested in.
I have a program that compares each line of two files, each line contains one word, if simply read the two files and stock the data into table, and compare the element of the two tables,
the first file contain:
straight
work
week
belief time
saturday
wagon
australia
sunday
french
...
and the second file contain
firepower
malaise
bryson
wagon
dalglish
french
...
this will take a long time to compare file, so I propose another solution, but this doesn't work
#!/usr/bin/perl
use strict;
use warnings;
open( FIC, $ARGV[0] );
open( FICC, $ARGV[1] );
print "choose the name of the file\n";
chomp( my $fic2 = <STDIN> );
open( FIC2, ">$fic2" );
my $i=0;
my $j=0;
my #b=();
my %stops;
while (<FIC>) #read each line into $_
{
# Remove newline from $_
chomp;
$_ =~ s/\s+$//;
$stops{$_} = $i; # add the line to
$i++;
}
close FIC;
while (<FICC>) {
my $ligne = $_;
$ligne =~ s/\s+$//;
$b[$i] = lc($ligne);
# $b contain the data
$i++;
}
foreach my $che (#b) {
chomp($che);
print FIC2 $che;
print FIC2 " ";
print FIC2 $stops{"$che"}; print FIC2 "\n";
#this returns nothing
}
The problem is inthis command $stop{"$che"}; in the case that the elment don't exist in the hash %stop, it return an integer and an error
Use of initalized value in print c:/ats2/hash.pl line 44, line 185B2
Does this what you want?
join <(sort file1) <(sort file2) >result
Works in bash.
When I run this code, I am purely trying to get all the lines containing the word "that" in them. Sounds easy enough. But when I run it, I get a list of matches that contain the word "that" but only at the end of the line. I don't know why it's coming out like this and I have been going crazy trying to solve it. I am currently getting an output of 268 total matches, and the output I need is only 13. Please advise!
#!/usr/bin/perl -w
#Usage: conc.shift.pl textfile word
open (FH, "$ARGV[0]") || die "cannot open";
#array = (1,2,3,4,5);
$count = 0;
while($line = <FH>) {
chomp $line;
shift #array;
push(#array, $line);
$count++;
if ($line =~ /that/)
{
$output = join(" ",#array);
print "$output \n";
}
}
print "Total matches: $count\n";
Don't you want to increment your $count variable only if the line contains "that", i.e.:
if ($line =~ /that/) {
$count++;
instead of incrementing the counter before checking if $line contains "that", as you have it:
$count++;
if ($line =~ /that/) {
Similarly, I suspect that your push() and join() calls, for stashing a matching line in #array, should also be within the if block, only executed if the line contains "that".
Hope this helps!
I am reading a text file which is having multiple lines in it. I have been assigned a task to print the lines using hash.
"\n" is the delimiter we can use.
Here is what I tried and got stuck :
code :
use strict;
use warnings;
my %hash = ();
my $key;
open (my $fh , "<","test.txt") or die "can not open the file $!\n";
while (my $line =<$fh>)
{
chomp ($line);
my($key, $number) = split("\n", $line)
$hash{$key} = [ $count, $number ];
}
i am not able to understand what will be my key in the hash. Can some one help me out to resolve the issue.
You have
while (my $line =<$fh>)
which reads a single record via $fh. The default input record separator in Perl is "\n" meaning you are reading the file line-by-line. By definition, a single line has a single line-terminator.
chomp ($line);
then removes this single "\n" from the string in $line.
Therefore,
my($key, $number) = split("\n", $line);
copies $line to $key, and leaves $number undefined as there is no "\n" in $line. Even if you had not chomped the line, $number would not contain anything useful because the line-terminator, by definition, would be at the end of the line and there would be nothing after it by virtue of the fact that it marks the end of the line.
If the file contains something along the lines of:
key1
value1
key2
value2
then you can read those one at a time.
I wrote this code and it works fine, it should find lines in which there's no string like 'SID' and append a pipe | at the beginning of the line, so like this: find all lines in which there's no 'SID' and append a pipe | at the beginning of the line. But how I wrote it, I can just output the lines which were changed and have a pipe. What I actually want: leave the file as it is and just append the pipes to the lines which match. Thank you.
#!usr/bin/perl
use strict;
use warnings;
use autodie;
my $fh;
open $fh, '<', 'file1.csv';
my $out = 'file2.csv';
open(FILE, '>', $out);
my $myline = "";
while (my $line = <$fh>) {
chomp $line;
unless ($line =~ m/^SID/) {
$line =~ m/^(.*)$/;
$myline = "\|$1";
}
print FILE $myline . "\n";
}
close $fh;
close FILE;
my file example:
SID,bla
foo bar <- my code adds the pipe to the beginning of this line
output should be like this:
SID,bla
| foo bar
but in my case I only print $myline, I know:
| foo bar
The line
$line =~ m/^(.*)$/
is misguided: all it does is put the contents of $line into $1, so the following statement
$myline = "\|$1"
may as well be
$myline = "|$line"
(The pipe | doesn't need escaping unless it is part of a regular expression.)
Since you are printing $myline at the end of your loop you are never seeing the contents of unmodified lines.
You can fix that by printing $line or $myline according to which one contains the required output, like this
while (my $line = <$fh>) {
chomp $line;
if ($line =~ m/^SID/) {
print "$line\n";
}
else {
my $myline = "|$line";
print "$myline\n";
}
}
or, much more simply, by dropping the intermediate variable and using the default $_ for the input lines, like this
while (<$fh>) {
print '|' unless /^SID/;
print;
}
Note that I have also removed the chomp as it just means you have to put the newline back on the end of the string when you print it.
Instead of creating a new variable $myline, use the one you already have:
while (my $line =<$fh>) {
$line = '|' . $line if $line !~ /^SID/;
print FILE $line;
}
Also, you can use lexical filehandle for the output file as well. Moreover, you should check the return value of open:
open my $OUT, '>', $out or die $!;