Populate an array by splitting a string - perl

Question

I am trying to convert a string into an array based on space delimiter.
My input file looks like this:
>Reference
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnn
nnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnctcACCATGGTGTCGACTC
TTCTATGGAAACAGCGTGGATGGCGTCTCCAGGCGATCTGACGGTTCACTAAACGAGCTC
Ignoring the line starting with >, the length of rest of the string is 360.
I am trying to convert this into an array.
Here's my code so far:
#!/usr/bin/perl
use strict;
use warnings;
#### To to change bases with less than 10X coverage to N #####
#### Take depth file and consensus fasta file as input arguments ####
my ($in2) = #ARGV;
my $args = $#ARGV + 1;
if ( $args != 1 ) {
print "Error!!! Insufficient Number of Argumrnts\n";
print "Usage: $0 <consensus fasta file> \n";
}
#### Open a filehandle to read in consensus fasta file ####
my $FH2;
my $line;
my #consensus;
my $char;
open($FH2, '<', $in2) || die "Could not open file $in2\n";
while ( <$FH2> ) {
$line = $_;
chomp $line;
next if $line =~ />/; # skip header line
$line =~ s/\s+//g;
my $len = length($line);
print "$len\n";
#print "$line";
#consensus = split(// , $line);
print "$#consensus\n";
#print "#consensus\n";
#for $char (0 .. $#consensus){
# print "$char: $consensus[$char]\n";
# }
}
The problem is the $len variable returns a value of 60 instead of 360 and $#consensus returns a value of 59 instead of 360 which is the length of the string.
I have removed the whitespace after each line with code $line =~ s/\s+//g;but it still is not working.

Answer 1

It looks like your code is essentially working. It's just your checking logic that makes no sense. I'd do the following:
use strict;
use warnings;
if (#ARGV != 1) {
print STDERR "Usage: $0 <consensus fasta file>\n";
exit 1;
}
open my $fh, '<', $ARGV[0] or die "$0: cannot open $ARGV[0]: $!\n";
my #consensus;
while (my $line = readline $fh) {
next if $line =~ /^>/;
$line =~ s/\s+//g;
push #consensus, split //, $line;
}
print "N = ", scalar #consensus, "\n";
Main things to note:
Error messages should go to STDERR, not STDOUT.
If an error occurs, the program should exit with an error code, not keep running.
Error messages should include the name of the program and the reason for the error.
chomp is redundant if you're going to remove all whitespace anyway.
As you're processing the input line by line, you can just keep pushing elements to the end of #consensus. At the end of the loop it'll have accumulated all characters across all lines.
Examining #consensus within the loop makes little sense as it hasn't finished building yet. Only after the loop do we have all characters we're interested in.