object main {
def main(args: Array[String]): Unit = {
for (
i <- 1 to 10
if i % 2 == 0;
j <- 2 to 8
if j % 2 == 1;
) {
println(s"i: ${i}, j: ${j}")
val t = i + j
println(s"t: ${t}")
}
}
}
Compiler complains: illegal start of simple pattern.
If I remove the second semicolon:
object main {
def main(args: Array[String]): Unit = {
for (
i <- 1 to 10
if i % 2 == 0;
j <- 2 to 8
if j % 2 == 1
) {
println(s"i: ${i}, j: ${j}")
val t = i + j
println(s"t: ${t}")
}
}
}
It works fine.
How to explain this behavior?
for comprehension can be defined using () or {}. Separator in case of () is ; and in case of {} is new line.
You are mixing both of them.
Try below (uses {} and new line separator):
object main {
def main(args: Array[String]): Unit = {
for {
i <- 1 to 10
if i % 2 == 0
j <- 2 to 8
if j % 2 == 1
} {
println(s"i: ${i}, j: ${j}")
val t = i + j
println(s"t: ${t}")
}
}
}
Below one uses () and ; separator:
object main {
def main(args: Array[String]): Unit = {
for (i <- 1 to 10 if i % 2 == 0; j <- 2 to 8 if j % 2 == 1) {
println(s"i: ${i}, j: ${j}")
val t = i + j
println(s"t: ${t}")
}
}
}
Related
I'm migrating from Java to Scala and I am trying to come up with the procedure merge for mergesort algorithm. My solution:
def merge(src: Array[Int], dst: Array[Int], from: Int,
mid: Int, until: Int): Unit = {
/*
* Iteration of merge:
* i - index of src[from, mid)
* j - index of src[mid, until)
* k - index of dst[from, until)
*/
#tailrec
def loop(i: Int, j: Int, k: Int): Unit = {
if (k >= until) {
// end of recursive calls
} else if (i >= mid) {
dst(k) = src(j)
loop(i, j + 1, k + 1)
} else if (j >= until) {
dst(k) = src(j)
loop(i + 1, j, k + 1)
} else if (src(i) <= src(j)) {
dst(k) = src(i);
loop(i + 1, j, k + 1)
} else {
dst(k) = src(j)
loop(i, j + 1, k + 1)
}
}
loop(from, mid, from)
}
seems to work, but it seems to me that it is written in quite "imperative" style
(despite i have used recursion and no mutable variables except for the arrays, for which the side effect is intended). I want something like this:
/*
* this code is not working and at all does the wrong things
*/
for (i <- (from until mid); j <- (mid until until);
k <- (from until until) if <???>) yield dst(k) = src(<???>)
But i cant come up with the proper solution of such kind. Can you please help me?
Consider this:
val left = src.slice(from, mid).buffered
val right = src.slice(mid, until).buffered
(from until until) foreach { k =>
dst(k) = if(!left.hasNext) right.next
else if(!right.hasNext || left.head < right.head) left.next
else right.next
}
As a beginner in Scala, I got a problem in SPOJ:
Peter wants to generate some prime numbers for his cryptosystem. Help him! Your task is to generate all prime numbers between two given numbers!
Input
The input begins with the number t of test cases in a single line (t<=10). In each of the next t lines there are two numbers m and n (1 <= m <= n <= 1000000000, n-m<=100000) separated by a space.
Output
For every test case print all prime numbers p such that m <= p <= n, one number per line, test cases separated by an empty line.
Example
Input:
2
1 10
3 5
Output:
2
3
5
7
3
5
`
Warning: large Input/Output data, be careful with certain languages (though most should be OK if the algorithm is well designed)
Run environment and requirement:
Added by: Adam Dzedzej
Date: 2004-05-01
Time limit: 6s
Source limit: 50000B
Memory limit: 1536MB
Cluster: Cube (Intel Pentium G860 3GHz)
Languages: All except: NODEJS PERL 6 SCM chicken
My code is here:
import math.sqrt
object Pro_2 {
def main(args: Array[String]) {
// judge whether a Long is a prime or not
def isPrime(num: Long): Boolean = {
num match {
case num if (num < 2) => false
case _ => {
2 to (sqrt(num) toInt) forall (num % _ != 0)
}
}
}
// if a Long is a prime print it in console
def printIfIsPrime(num: Long) = {
if (isPrime(num))
println(num)
}
// get range
def getInput(times: Int) = {
for (input <- 0 until times) yield {
val range = readLine().split(" ")
(range(0) toLong, range(1) toLong)
}
}
val ranges = getInput(readInt())
for (time <- 0 until ranges.length) {
(ranges(time)._1 to ranges(time)._2).foreach(printIfIsPrime(_))
if (time != ranges.length - 1)
println()
}
}
}
When I run my code in SPOJ, I got a result: time limit exceeded
I need make my code more efficient, could you please help me?
Any help would be greatly appreciated.
isPrime could be written in a lower level style. Also you can increase the speed of the println method.
def main(args: Array[String]) {
val out = new java.io.PrintWriter(System.out, false)
def isPrime(n: Long): Boolean = {
if(n <= 3) return n > 1
else if(n%2 == 0 || n%3 == 0) return false
else {
var i = 5
while(i*i <= n) {
if(n%i == 0 || n%(i+2) == 0) return false
i += 6
}
return true
}
}
def printIfIsPrime(num: Long) = {
if (isPrime(num)) {
out.println(num)
}
}
...
val ranges = getInput(readInt())
for (time <- 0 until ranges.length) {
(ranges(time)._1 to ranges(time)._2).foreach(printIfIsPrime(_))
if (time != ranges.length - 1)
out.println()
}
out.flush()
}
Below code searches for a motif (of length 8) in a sequence(String) and, as the result, it has to give back sequence with the best score. The problem is, although the code produces no errors, there is no output at all (probably infinite cycle, I observe blank console).
I am gonna give all my code online and if that is required. In order to reproduce the problem, just pass a number (between 0 and 3 - you can give 4 sequence, so you must choose 1 of them 0 is the first , 1 is the second etc) as args(0) (e.g. "0"), expected output should look something like "Motif = ctgatgta"
import scala.util.control._
object BranchAndBound {
var seq: Array[String] = new Array[String](20)
var startPos: Array[Int] = new Array[Int](20)
var pickup: Array[String] = new Array[String](20)
var bestMotif: Array[Int] = new Array[Int](20)
var ScoreMatrix = Array.ofDim[Int](5, 20)
var i: Int = _
var j: Int = _
var lmer: Int = _
var t: Int = _
def main(args: Array[String]) {
var t1: Long = 0
var t2: Long = 0
t1 = 0
t2 = 0
t1 = System.currentTimeMillis()
val seq0 = Array(
Array(
" >5 regulatory reagions with 69 bp",
" cctgatagacgctatctggctatccaggtacttaggtcctctgtgcgaatctatgcgtttccaaccat",
" agtactggtgtacatttgatccatacgtacaccggcaacctgaaacaaacgctcagaaccagaagtgc",
" aaacgttagtgcaccctctttcttcgtggctctggccaacgagggctgatgtataagacgaaaatttt",
" agcctccgatgtaagtcatagctgtaactattacctgccacccctattacatcttacgtccatataca",
" ctgttatacaacgcgtcatggcggggtatgcgttttggtcgtcgtacgctcgatcgttaccgtacggc"),
Array(
" 2 columns mutants",
" cctgatagacgctatctggctatccaggtacttaggtcctctgtgcgaatctatgcgtttccaaccat",
" agtactggtgtacatttgatccatacgtacaccggcaacctgaaacaaacgctcagaaccagaagtgc",
" aaacgttagtgcaccctctttcttcgtggctctggccaacgagggctgatgtataagacgaaaattttt",
" agcctccgatgtaagtcatagctgtaactattacctgccacccctattacatcttacgtccatataca",
" ctgttatacaacgcgtcatggcggggtatgcgttttggtcgtcgtacgctcgatcgttaccgtacggc"),
Array(
" 2 columns mutants",
" cctgatagacgctatctggctatccaggtacttaggtcctctgtgcgaatctatgcgtttccaaccat",
" agtactggtgtacatttgatccatacgtacaccggcaacctgaaacaaacgctcagaaccagaagtgc",
" aaacgttagtgcaccctctttcttcgtggctctggccaacgagggctgatgtataagacgaaaattttt",
" agcctccgatgtaagtcatagctgtaactattacctgccacccctattacatcttacgtccatataca",
" ctgttatacaacgcgtcatggcggggtatgcgttttggtcgtcgtacgctcgatcgttaccgtacggc"),
Array(
" 2 columns mutants",
" cctgatagacgctatctggctatccaggtacttaggtcctctgtgcgaatctatgcgtttccaaccat",
" agtactggtgtacatttgatccatacgtacaccggcaacctgaaacaaacgctcagaaccagaagtgc",
" aaacgttagtgcaccctctttcttcgtggctctggccaacgagggctgatgtataagacgaaaattttt",
" agcctccgatgtaagtcatagctgtaactattacctgccacccctattacatcttacgtccatataca",
" ctgttatacaacgcgtcatggcggggtatgcgttttggtcgtcgtacgctcgatcgttaccgtacggc"))
var k: Int = 0
var m: Int = 0
var n: Int = 0
var bestScore: Int = 0
var optScore: Int = 0
var get: Int = 0
var ok1: Boolean = false
var ok3: Boolean = false
ok1 = false
ok3 = false
j = 1
lmer = 8
m = 1
t = 5
n = 69
optScore = 0
bestScore = 0
k = java.lang.Integer.parseInt(args(0))
j = 1
while (j <= t) {
seq(j) = new String()
i = 0
while (i < n) {
seq(j) += seq0(k)(j).charAt(i)
i += 1
}
j += 1
}
j = 1
while (j <= t) {
newPickup(1, j)
j += 1
}
j = 0
bestScore = 0
i = 1
val whilebreaker = new Breaks
whilebreaker.breakable {
while (i > 0) {
if (i < t) {
if (startPos(1) == (n - lmer)) whilebreaker.break
val sc = Score()
optScore = sc + (t - i) * lmer
if (optScore < bestScore) {
ok1 = false
j = i
val whilebreak1 = new Breaks
whilebreak1.breakable {
while (j >= 1) {
if (startPos(j) < n - lmer) {
ok1 = true
newPickup(0, j)
whilebreak1.break
} else {
ok1 = true
newPickup(1, j)
val whilebreak2 = new Breaks
whilebreak2.breakable {
while (startPos(i - 1) == (n - lmer)) {
newPickup(1, i - 1)
i -= 1
if (i == 0) whilebreak2.break
}
}
if (i > 1) {
newPickup(0, i - 1)
i -= 1
}
whilebreak1.break
}
}
}
if (ok1 == false) i = 0
} else {
newPickup(1, i + 1)
i += 1
}
} else {
get = Score()
if (get > bestScore) {
bestScore = get
m = 1
while (m <= t) {
bestMotif(m) = startPos(m)
m += 1
}
}
ok3 = false
j = t
val whilebreak3 = new Breaks
whilebreak3.breakable {
while (j >= 1) {
if (startPos(j) < n - lmer) {
ok3 = true
newPickup(0, j)
whilebreak3.break
} else {
ok3 = true
newPickup(1, j)
val whilebreak4 = new Breaks
whilebreak4.breakable {
while (startPos(i - 1) == (n - lmer)) {
newPickup(1, i - 1)
i -= 1
if (i == 0) whilebreak4.break
}
}
if (i > 1) {
newPickup(0, i - 1)
i -= 1
}
whilebreak3.break
}
}
}
if (ok3 == false) i = 0
}
}
}
println("Motiv: " + Consensus())
// println()
j = 1
while (j <= t) {
t2 = System.currentTimeMillis()
j += 1
}
println("time= " + (t2 - t1) + " ms")
}
def Score(): Int = {
var j: Int = 0
var k: Int = 0
var m: Int = 0
var max: Int = 0
var sum: Int = 0
sum = 0
max = 0
m = 1
while (m <= lmer) {
k = 1
while (k <= 4) {
ScoreMatrix(k)(m) = 0
k += 1
}
m += 1
}
m = 1
while (m <= lmer) {
k = 1
while (k <= i) pickup(k).charAt(m) match {
case 'a' => ScoreMatrix(1)(m) += 1
case 'c' => ScoreMatrix(2)(m) += 1
case 'g' => ScoreMatrix(3)(m) += 1
case 't' => ScoreMatrix(4)(m) += 1
}
m += 1
}
j = 1
while (j <= lmer) {
max = 0
m = 1
while (m <= 4) {
if (ScoreMatrix(m)(j) > max) {
max = ScoreMatrix(m)(j)
}
m += 1
}
sum += max
j += 1
}
sum
}
def Consensus(): String = {
var i: Int = 0
var j: Int = 0
var k: Int = 0
var m: Int = 0
var max: Int = 0
var imax: Int = 0
var str: String = null
i = 1
while (i <= t) {
pickup(i) = " " +
seq(i).substring(bestMotif(i), bestMotif(i) + lmer)
i += 1
}
m = 1
while (m <= lmer) {
k = 1
while (k <= 4) {
ScoreMatrix(k)(m) = 0
k += 1
}
m += 1
}
m = 1
while (m <= lmer) {
k = 1
while (k <= t) pickup(k).charAt(m) match {
case 'a' => ScoreMatrix(1)(m) += 1
case 'c' => ScoreMatrix(2)(m) += 1
case 'g' => ScoreMatrix(3)(m) += 1
case 't' => ScoreMatrix(4)(m) += 1
}
m += 1
}
str = ""
imax = 0
j = 1
while (j <= lmer) {
max = 0
i = 1
while (i <= 4) {
if (ScoreMatrix(i)(j) > max) {
max = ScoreMatrix(i)(j)
imax = i
}
i += 1
}
imax match {
case 1 => str += 'a'
case 2 => str += 'c'
case 3 => str += 'g'
case 4 => str += 't'
}
j += 1
}
str
}
def newPickup(one: Int, h: Int) {
if (one == 1) startPos(h) = 1 else startPos(h) += 1
pickup(h) = " " + seq(h).substring(startPos(h), startPos(h) + lmer)
}
}
and thanks, i hope someone gonna find my failure.
Your current implementation 'hangs' on this loop:
while (k <= i) pickup(k).charAt(m) match {
case 'a' => ScoreMatrix(1)(m) += 1
case 'c' => ScoreMatrix(2)(m) += 1
case 'g' => ScoreMatrix(3)(m) += 1
case 't' => ScoreMatrix(4)(m) += 1
}
As it stands, the exit condition is never fulfilled because the relation between k and i never changes. Either increment k or decrement i.
It looks like programming is not the key aspect of this work, but increased modularity should help contain complexity.
Also, I wonder about the choice of using Scala. There're many areas in this algorithm that would benefit of a more functional approach. In this translation, using Scala in an imperative way gets cumbersome. If you have the opportunity, I'd recommend you to explore a more functional approach to solve this problem.
A tip: The intellij debugger didn't have issues with this code.
I worked on the Prime Generator problem for almost 3 days.
I want to make a Scala functional solution(which means "no var", "no mutable data"), but every time it exceed the time limitation.
My solution is:
object Main {
def sqrt(num: Int) = math.sqrt(num).toInt
def isPrime(num: Int): Boolean = {
val end = sqrt(num)
def isPrimeHelper(current: Int): Boolean = {
if (current > end) true
else if (num % current == 0) false
else isPrimeHelper(current + 1)
}
isPrimeHelper(2)
}
val feedMax = sqrt(1000000000)
val feedsList = (2 to feedMax).filter(isPrime)
val feedsSet = feedsList.toSet
def findPrimes(min: Int, max: Int) = (min to max) filter {
num => if (num <= feedMax) feedsSet.contains(num)
else feedsList.forall(p => num % p != 0 || p * p > num)
}
def main(args: Array[String]) {
val total = readLine().toInt
for (i <- 1 to total) {
val Array(from, to) = readLine().split("\\s+")
val primes = findPrimes(from.toInt, to.toInt)
primes.foreach(println)
println()
}
}
}
I'm not sure where can be improved. I also searched a lot, but can't find a scala solution(most are c/c++ ones)
Here is a nice fully functional scala solution using the sieve of eratosthenes: http://en.literateprograms.org/Sieve_of_Eratosthenes_(Scala)#chunk def:ints
Check out this elegant and efficient one liner by Daniel Sobral: http://dcsobral.blogspot.se/2010/12/sieve-of-eratosthenes-real-one-scala.html?m=1
lazy val unevenPrimes: Stream[Int] = {
def nextPrimes(n: Int, sqrt: Int, sqr: Int): Stream[Int] =
if (n > sqr) nextPrimes(n, sqrt + 1, (sqrt + 1)*(sqrt + 1)) else
if (unevenPrimes.takeWhile(_ <= sqrt).exists(n % _ == 0)) nextPrimes(n + 2, sqrt, sqr)
else n #:: nextPrimes(n + 2, sqrt, sqr)
3 #:: 5 #:: nextPrimes(7, 3, 9)
}
I am trying to learn scala, here I am using basic for loop, but I am getting errors while compiling.
object App {
def main(args: Array[String]) {
for (i <- 1 to 10; i % 2 == 0)
Console.println("Counting " + i)
}
}
Errors while compiling :
fortest.scala:5: error: '<-' expected but ')' found.
for (i <- 1 to 10; i % 2 == 0)
^
fortest.scala:7: error: illegal start of simple expression
}
^
two errors found
I am using scala version 2.9.1
Any idea what is the problem..............?
for (i <- 1 to 10 if i % 2 == 0)
println("Counting " + i)
Scala is not Java, thus you cannot use a regular Java syntax. Instead you have to do:
for{
i <- 1 to 10
if(i % 2 == 0)
}{println("Counting " + i)}
or with ; delimeters, inside the (,) parentheses:
for(i <- 1 to 10;if(i % 2 == 0)){
println("Counting " + i)
}
Also, note that Scala's for expressions, have some pretty nifty capabilities.
you can use a for expression with multiple "loop iterators" and conditions.
For instance, instead of writing:
for(i <- 1 to n; if(someCondition(i)){
for(j <- 1 to m; if(otherCondition(j)){
//Do something
}
}
You can simply write:
for{
i <- 1 to n
if(someCondition(i))
j <- 1 to m
if(otherCondition(j))
}{
//Do something
}
SIDE NOTE:
When you extend App (there's a trait of that name in Predef), you don't need to define a main method. You can simply write your code between the curly braces of object:
object MyClazz extends App {
for(i <- 1 to 10;if(i % 2 == 0)){
println("Counting " + i)
}
}
Take a look at the "by" method of the Range class to count by 2
object App {
def main(args: Array[String]) {
for (i <- 2 to 10 by 2)
Console.println("Counting " + i)
}
}
Or, like others have already stated you can fix your loop by doing
object App {
def main(args: Array[String]) {
for {
i <- 1 to 10
if i % 2 == 0
}
Console.println("Counting " + i)
}
}
Or another way:
object App {
def main(args: Array[String]) {
val evenNumbers = for {
i <- 1 to 10
if i % 2 == 0
} yield i
Console.println(evenNumbers.mkString("\n"))
}
}
The modulo 2 condition can be moved to an if clause.
object App {
def main(args: Array[String]) {
for (i <- 1 to 10)
if(i % 2 == 0)
Console.println("Counting " + i)
}
}
Here is the simply example;
for (i <- List(1, 2, 3) if i < 2) println(i)
The best way to exam your code is to use scala shell.
Basically, you are trying to use for-loop + iterator gaurd. Please find below syntax
for ( i <- 1 to 10 if (i%2==0) ) yield i