Below code searches for a motif (of length 8) in a sequence(String) and, as the result, it has to give back sequence with the best score. The problem is, although the code produces no errors, there is no output at all (probably infinite cycle, I observe blank console).
I am gonna give all my code online and if that is required. In order to reproduce the problem, just pass a number (between 0 and 3 - you can give 4 sequence, so you must choose 1 of them 0 is the first , 1 is the second etc) as args(0) (e.g. "0"), expected output should look something like "Motif = ctgatgta"
import scala.util.control._
object BranchAndBound {
var seq: Array[String] = new Array[String](20)
var startPos: Array[Int] = new Array[Int](20)
var pickup: Array[String] = new Array[String](20)
var bestMotif: Array[Int] = new Array[Int](20)
var ScoreMatrix = Array.ofDim[Int](5, 20)
var i: Int = _
var j: Int = _
var lmer: Int = _
var t: Int = _
def main(args: Array[String]) {
var t1: Long = 0
var t2: Long = 0
t1 = 0
t2 = 0
t1 = System.currentTimeMillis()
val seq0 = Array(
Array(
" >5 regulatory reagions with 69 bp",
" cctgatagacgctatctggctatccaggtacttaggtcctctgtgcgaatctatgcgtttccaaccat",
" agtactggtgtacatttgatccatacgtacaccggcaacctgaaacaaacgctcagaaccagaagtgc",
" aaacgttagtgcaccctctttcttcgtggctctggccaacgagggctgatgtataagacgaaaatttt",
" agcctccgatgtaagtcatagctgtaactattacctgccacccctattacatcttacgtccatataca",
" ctgttatacaacgcgtcatggcggggtatgcgttttggtcgtcgtacgctcgatcgttaccgtacggc"),
Array(
" 2 columns mutants",
" cctgatagacgctatctggctatccaggtacttaggtcctctgtgcgaatctatgcgtttccaaccat",
" agtactggtgtacatttgatccatacgtacaccggcaacctgaaacaaacgctcagaaccagaagtgc",
" aaacgttagtgcaccctctttcttcgtggctctggccaacgagggctgatgtataagacgaaaattttt",
" agcctccgatgtaagtcatagctgtaactattacctgccacccctattacatcttacgtccatataca",
" ctgttatacaacgcgtcatggcggggtatgcgttttggtcgtcgtacgctcgatcgttaccgtacggc"),
Array(
" 2 columns mutants",
" cctgatagacgctatctggctatccaggtacttaggtcctctgtgcgaatctatgcgtttccaaccat",
" agtactggtgtacatttgatccatacgtacaccggcaacctgaaacaaacgctcagaaccagaagtgc",
" aaacgttagtgcaccctctttcttcgtggctctggccaacgagggctgatgtataagacgaaaattttt",
" agcctccgatgtaagtcatagctgtaactattacctgccacccctattacatcttacgtccatataca",
" ctgttatacaacgcgtcatggcggggtatgcgttttggtcgtcgtacgctcgatcgttaccgtacggc"),
Array(
" 2 columns mutants",
" cctgatagacgctatctggctatccaggtacttaggtcctctgtgcgaatctatgcgtttccaaccat",
" agtactggtgtacatttgatccatacgtacaccggcaacctgaaacaaacgctcagaaccagaagtgc",
" aaacgttagtgcaccctctttcttcgtggctctggccaacgagggctgatgtataagacgaaaattttt",
" agcctccgatgtaagtcatagctgtaactattacctgccacccctattacatcttacgtccatataca",
" ctgttatacaacgcgtcatggcggggtatgcgttttggtcgtcgtacgctcgatcgttaccgtacggc"))
var k: Int = 0
var m: Int = 0
var n: Int = 0
var bestScore: Int = 0
var optScore: Int = 0
var get: Int = 0
var ok1: Boolean = false
var ok3: Boolean = false
ok1 = false
ok3 = false
j = 1
lmer = 8
m = 1
t = 5
n = 69
optScore = 0
bestScore = 0
k = java.lang.Integer.parseInt(args(0))
j = 1
while (j <= t) {
seq(j) = new String()
i = 0
while (i < n) {
seq(j) += seq0(k)(j).charAt(i)
i += 1
}
j += 1
}
j = 1
while (j <= t) {
newPickup(1, j)
j += 1
}
j = 0
bestScore = 0
i = 1
val whilebreaker = new Breaks
whilebreaker.breakable {
while (i > 0) {
if (i < t) {
if (startPos(1) == (n - lmer)) whilebreaker.break
val sc = Score()
optScore = sc + (t - i) * lmer
if (optScore < bestScore) {
ok1 = false
j = i
val whilebreak1 = new Breaks
whilebreak1.breakable {
while (j >= 1) {
if (startPos(j) < n - lmer) {
ok1 = true
newPickup(0, j)
whilebreak1.break
} else {
ok1 = true
newPickup(1, j)
val whilebreak2 = new Breaks
whilebreak2.breakable {
while (startPos(i - 1) == (n - lmer)) {
newPickup(1, i - 1)
i -= 1
if (i == 0) whilebreak2.break
}
}
if (i > 1) {
newPickup(0, i - 1)
i -= 1
}
whilebreak1.break
}
}
}
if (ok1 == false) i = 0
} else {
newPickup(1, i + 1)
i += 1
}
} else {
get = Score()
if (get > bestScore) {
bestScore = get
m = 1
while (m <= t) {
bestMotif(m) = startPos(m)
m += 1
}
}
ok3 = false
j = t
val whilebreak3 = new Breaks
whilebreak3.breakable {
while (j >= 1) {
if (startPos(j) < n - lmer) {
ok3 = true
newPickup(0, j)
whilebreak3.break
} else {
ok3 = true
newPickup(1, j)
val whilebreak4 = new Breaks
whilebreak4.breakable {
while (startPos(i - 1) == (n - lmer)) {
newPickup(1, i - 1)
i -= 1
if (i == 0) whilebreak4.break
}
}
if (i > 1) {
newPickup(0, i - 1)
i -= 1
}
whilebreak3.break
}
}
}
if (ok3 == false) i = 0
}
}
}
println("Motiv: " + Consensus())
// println()
j = 1
while (j <= t) {
t2 = System.currentTimeMillis()
j += 1
}
println("time= " + (t2 - t1) + " ms")
}
def Score(): Int = {
var j: Int = 0
var k: Int = 0
var m: Int = 0
var max: Int = 0
var sum: Int = 0
sum = 0
max = 0
m = 1
while (m <= lmer) {
k = 1
while (k <= 4) {
ScoreMatrix(k)(m) = 0
k += 1
}
m += 1
}
m = 1
while (m <= lmer) {
k = 1
while (k <= i) pickup(k).charAt(m) match {
case 'a' => ScoreMatrix(1)(m) += 1
case 'c' => ScoreMatrix(2)(m) += 1
case 'g' => ScoreMatrix(3)(m) += 1
case 't' => ScoreMatrix(4)(m) += 1
}
m += 1
}
j = 1
while (j <= lmer) {
max = 0
m = 1
while (m <= 4) {
if (ScoreMatrix(m)(j) > max) {
max = ScoreMatrix(m)(j)
}
m += 1
}
sum += max
j += 1
}
sum
}
def Consensus(): String = {
var i: Int = 0
var j: Int = 0
var k: Int = 0
var m: Int = 0
var max: Int = 0
var imax: Int = 0
var str: String = null
i = 1
while (i <= t) {
pickup(i) = " " +
seq(i).substring(bestMotif(i), bestMotif(i) + lmer)
i += 1
}
m = 1
while (m <= lmer) {
k = 1
while (k <= 4) {
ScoreMatrix(k)(m) = 0
k += 1
}
m += 1
}
m = 1
while (m <= lmer) {
k = 1
while (k <= t) pickup(k).charAt(m) match {
case 'a' => ScoreMatrix(1)(m) += 1
case 'c' => ScoreMatrix(2)(m) += 1
case 'g' => ScoreMatrix(3)(m) += 1
case 't' => ScoreMatrix(4)(m) += 1
}
m += 1
}
str = ""
imax = 0
j = 1
while (j <= lmer) {
max = 0
i = 1
while (i <= 4) {
if (ScoreMatrix(i)(j) > max) {
max = ScoreMatrix(i)(j)
imax = i
}
i += 1
}
imax match {
case 1 => str += 'a'
case 2 => str += 'c'
case 3 => str += 'g'
case 4 => str += 't'
}
j += 1
}
str
}
def newPickup(one: Int, h: Int) {
if (one == 1) startPos(h) = 1 else startPos(h) += 1
pickup(h) = " " + seq(h).substring(startPos(h), startPos(h) + lmer)
}
}
and thanks, i hope someone gonna find my failure.
Your current implementation 'hangs' on this loop:
while (k <= i) pickup(k).charAt(m) match {
case 'a' => ScoreMatrix(1)(m) += 1
case 'c' => ScoreMatrix(2)(m) += 1
case 'g' => ScoreMatrix(3)(m) += 1
case 't' => ScoreMatrix(4)(m) += 1
}
As it stands, the exit condition is never fulfilled because the relation between k and i never changes. Either increment k or decrement i.
It looks like programming is not the key aspect of this work, but increased modularity should help contain complexity.
Also, I wonder about the choice of using Scala. There're many areas in this algorithm that would benefit of a more functional approach. In this translation, using Scala in an imperative way gets cumbersome. If you have the opportunity, I'd recommend you to explore a more functional approach to solve this problem.
A tip: The intellij debugger didn't have issues with this code.
Related
Write a program in Scala that reads an String from the keyboard and counts the number of characters, ignoring if its UpperCase or LowerCase
ex: Avocado
R: A = 2; v = 1; o = 2; c = 1; d = 2;
So, i tried to do it with two fors iterating over the string, and then a conditional to transform the character in the position (x) to Upper and compare with the character in the position (y) which is the same position... basically i'm transforming the same character so i can increment in the counter ex: Ava -> A = 2; v = 1;
But with this logic when i print the result it comes with:
ex: Avocado
R: A = 2; v = 1; o = 2; c = 1; a = 2; d = 1; o = 2;
its repeting the same character Upper or Lower in the result...
so my teacher asked us to resolve this using the split method and yield of Scala but i dunno how to use the split without forEach() that he doesnt allow us to use.
sorry for the bad english
object ex8 {
def main(args: Array[String]): Unit = {
println("Write a string")
var string = readLine()
var cont = 0
for (x <- 0 to string.length - 1) {
for (y <- 0 to string.length - 1) {
if (string.charAt(x).toUpper == string.charAt(y).toUpper)
cont += 1
}
print(string.charAt(x) + " = " + cont + "; ")
cont = 0
}
}
}
But with this logic when i print the result it comes with:
ex: Avocado
R: A = 2; V = 1; o = 2; c = 1; a = 2; d = 1; o = 2;
Scala 2.13 has added a very handy method to cover this sort of thing.
inputStr.groupMapReduce(_.toUpper)(_ => 1)(_+_)
.foreach{case (k,v) => println(s"$k = $v")}
//A = 2
//V = 1
//C = 1
//O = 2
//D = 1
It might be easier to group the individual elements of the String (i.e. a collection of Chars, made case-insensitive with toLower) to aggregate their corresponding size using groupBy/mapValues:
"Avocado".groupBy(_.toLower).mapValues(_.size)
// res1: scala.collection.immutable.Map[Char,Int] =
// Map(a -> 2, v -> 1, c -> 1, o -> 2, d -> 1)
Scala 2.11
Tried with classic word count approach of map => group => reduce
val exampleStr = "Avocado R"
exampleStr.
toLowerCase.
trim.
replaceAll(" +","").
toCharArray.map(x => (x,1)).groupBy(_._1).
map(x => (x._1,x._2.length))
Answer :
exampleStr: String = Avocado R
res3: scala.collection.immutable.Map[Char,Int] =
Map(a -> 2, v -> 1, c -> 1, r -> 1, o -> 2, d -> 1)
I have 3 different objects that I've written in IDEA, labelled PartA, PartB, and PartC. However, when I attempt to run any of these objects, the only one that gives me the option to run is PartB. When I right click on the code for PartA and PartC, I have no option to run them. Only PartB has the option to run. What's going on here, and how can I fix it so I can run the different objects I have written?
Edit: Sorry, first time posting a question here. Here's the code I have written.
object PartB extends App {
def easter(Y:Int): Int = {
val N = Y - 1900
val A = N - (N/19) * 19
val B = (7 * A + 1) / 19
val C = 11 * A + 4 - B
val M = C - (C / 29) * 29
val Q = N / 4
val S = N + Q + 31 - M
val W = S - (S / 7) * 7
val DATE = 25 - M - W
return DATE
}
println("Enter a year: ")
val year = scala.io.StdIn.readInt()
val date = easter(year)
var easter_day : String = ""
if (date == 0) {
easter_day = "March, 31"
} else if (date < 0) {
easter_day = "March, " + (31 + year)
} else {
easter_day = "April, " + date
}
println("In " + year + ", Easter is on " + easter_day + ".")
}
////////////////////////////////////////////////////////////////////////////////
object PartC {
def ack(m:Int, n:Int) : Int = {
if (m == 0) {
return n + 1
} else if (n == 0) {
return ack(m - 1, 1)
} else {
return ack(m - 1, ack(m, n - 1))
}
}
println("Enter a value for m: ")
val m = scala.io.StdIn.readInt()
println("Enter a value for n: ")
val n = scala.io.StdIn.readInt()
println(ack(m, n))
}
PartB extends App, but PartC doesn't. Presumably PartA doesn't either.
The App trait can be used to quickly turn objects into executable programs... the whole class body becomes the “main method”.
So PartB defines a main method.
import java.io.File
import javax.imageio.ImageIO
import java.awt.image.BufferedImage
val img = ImageIO.read(newFile("Filename.jpg"))
val w = img.getWidth
val h = img.getHeight
for (x <- 0 until w)
for (y <- 0 until h)
img.getRGB(x,y)
ImageIO.write(img,"jpg",new File("test.jpg"))
How to convert img to byte array and count the green pixels in the same.
You can count the green pixel by comparing RGB value of each pixel with RGB value of Green color.
Example:
...
val w = img.getWidth
val h = img.getHeight
val green = Color.GREEN
var ctrGreen = 0
var ctrTotal = 0
for (x <- 0 until w)
for (y <- 0 until h) {
val c = new Color(img.getRGB(x, y))
if (isEqual(c, green)) {
ctrGreen += 1
}
ctrTotal += 1;
}
println("Green pixel count: " + ctrGreen)
println("Total pixel count: " + ctrTotal)
}
def isEqual(c1: Color, c2: Color): Boolean = {
c1.getRed == c2.getRed && c1.getBlue == c2.getBlue && c1.getGreen == c2.getGreen
}
But sometime it is hard to find the exact match for color's RGB value (i.e. in case of green it is (0,255,0) ). So you can also check whether a pixel belongs to a color range or not. Example:
....
val lightGreen = new Color(0,255,0)
val darkGreen = new Color(0,100,0)
var ctrGreen = 0
var ctrTotal = 0
for (x <- 0 until w)
for (y <- 0 until h) {
val c = new Color(img.getRGB(x, y))
if (isBetween(c, lightGreen,darkGreen)) {
ctrGreen += 1
}
ctrTotal += 1;
}
println("Green pixel count: " + ctrGreen)
println("Total pixel count: " + ctrTotal)
}
def isBetween(c: Color, c1: Color, c2: Color): Boolean = {
c.getRed >= c1.getRed && c.getRed <= c2.getRed && c.getBlue >= c1.getBlue && c.getBlue <= c2.getBlue && c.getGreen <= c1.getGreen && c.getGreen >= c2.getGreen
}
Can "foreach" can be used for each element of the 2-D List/Array?
I tried the code:
val n_vec = (0 to 2).map(i=>
(0 to 2).map(j=>
Wire(UInt(3.W))
)
)
n_vec.foreach((i:Int)=>(
n_vec(i).foreach((j:Int)=>{
n_vec(i)(j) := i.U + j.U
})
))
the error message is
top.scala:24: error: type mismatch;
found : Int => Unit
required: chisel3.core.UInt => ?
n_vec(i).foreach((j:Int)=>{
^
Could you enlight me whether it can be used in such a way, even how?
It would be cleaner to write like this:
n_vec.foreach { i=>
i.foreach { j=>
j := x.U + y.U
y = y + 1
}
y = 0
x = x + 1
}
But you don't need to increment x and y manually, just iterate over indices instead:
n_vec.indices.foreach { x =>
n_vec(x).indices.foreach { y =>
n_vec(x)(y) := x.U + y.U
}
}
or better (and this translates exactly to the above)
for {
x <- n_vec.indices
y <- n_vec(x).indices
} {
n_vec(x)(y) := x.U + y.U
}
Yes it can be used this way.
solution:
var x = 0
var y = 0
n_vec.foreach(i=>{
i.foreach(j=>{
j := x.U + y.U
y = y + 1
})
y = 0
x = x + 1
})
x = 0
y = 0
Below is a binary search algorithm but its not finding the value :
I don't think this algorithm is correct?
'theArray' is initialised to an array of 0's with item at position 7 equal to 4.
object various {
//O(log N)
def binarySerachForValue(value : Int) = {
var arraySize = 100
var theArray = new Array[Int](arraySize)
theArray(7) = 4
var timesThrough = 0
var lowIndex = 0
var highIndex = arraySize - 1
while(lowIndex <= highIndex){
var middleIndex = (highIndex + lowIndex) / 2
if(theArray(middleIndex) < value)
lowIndex = middleIndex + 1
else if(theArray(middleIndex) > value)
highIndex = middleIndex - 1
else {
println("Found match in index " + middleIndex)
lowIndex = highIndex + 1
}
timesThrough = timesThrough + 1
}
timesThrough
} //> binarySerachForValue: (value: Int)Int
binarySerachForValue(4) //> res0: Int = 7
}
Assuming your array is already properly sorted, you could write your search function a little more functionally using tail optimized recursion as follows:
def binarySearchForValue(value : Int, theArray:Array[Int]) = {
#tailrec
def doSearch(arr:Array[Int], index:Int = 0):Int = {
val middleIndex = arr.size / 2
val splits = arr.splitAt(middleIndex)
val totalIndex = middleIndex + index
arr(middleIndex) match{
case i if i == value => totalIndex
case i if i < value => doSearch(splits._2, totalIndex)
case _ => doSearch(splits._1 dropRight(1), totalIndex)
}
}
doSearch(theArray)
}
Note that this could also be accomplished slightly differently as follows:
def binarySearchForValue(value : Int, theArray:Array[Int]) = {
#tailrec
def doSearch(low:Int, high:Int):Int = {
val mid = (low + high) / 2
if(mid >= theArray.size) -1
else {
val currval = theArray(mid)
if (currval == value) mid
else if (currval < value) doSearch(mid+1, high)
else doSearch(low, mid - 1)
}
}
doSearch(0, theArray.size)
}
It looks like a proper implementation of the Binary Search Algorithm, but you are providing an array of 0's, with just one number at the index of 7. Binary Search usually takes an array of sorted values (although you can implement sorting as the first step).
Here is an example of why you need a sorted array first:
Searchfor(4)
theArray = [0,4,0,0,0]
First iteration, look at theArray(2), which equals 0. 0 < 4, so use the upperhalf(i.e. lower index = middleindex + 1
newArray = [0,0]
Then we iterate again and eventually exit the loop because we never found it. With a sorted list, your technique would work well.
With finding a single value in an array of 0's, your best bet is to just iterate through the array until you find it. Best of Luck.
loop should be like this:
while(lowIndex <= highIndex){
//note the lowIndex + other
var middleIndex = lowIndex + ((highIndex + lowIndex) / 2)
if(theArray(middleIndex) < value)
lowIndex = middleIndex + 1
else if(theArray(middleIndex) > value)
highIndex = middleIndex - 1
else return middleIndex
timesThrough = timesThrough + 1
}
// if loop finished and not returned middleIndex in last else, return -1 (not found)
return -1