Scala Branch And Bound Motif Search - scala

Question

Below code searches for a motif (of length 8) in a sequence(String) and, as the result, it has to give back sequence with the best score. The problem is, although the code produces no errors, there is no output at all (probably infinite cycle, I observe blank console).
I am gonna give all my code online and if that is required. In order to reproduce the problem, just pass a number (between 0 and 3 - you can give 4 sequence, so you must choose 1 of them 0 is the first , 1 is the second etc) as args(0) (e.g. "0"), expected output should look something like "Motif = ctgatgta"
import scala.util.control._
object BranchAndBound {
var seq: Array[String] = new Array[String](20)
var startPos: Array[Int] = new Array[Int](20)
var pickup: Array[String] = new Array[String](20)
var bestMotif: Array[Int] = new Array[Int](20)
var ScoreMatrix = Array.ofDim[Int](5, 20)
var i: Int = _
var j: Int = _
var lmer: Int = _
var t: Int = _
def main(args: Array[String]) {
var t1: Long = 0
var t2: Long = 0
t1 = 0
t2 = 0
t1 = System.currentTimeMillis()
val seq0 = Array(
Array(
" >5 regulatory reagions with 69 bp",
" cctgatagacgctatctggctatccaggtacttaggtcctctgtgcgaatctatgcgtttccaaccat",
" agtactggtgtacatttgatccatacgtacaccggcaacctgaaacaaacgctcagaaccagaagtgc",
" aaacgttagtgcaccctctttcttcgtggctctggccaacgagggctgatgtataagacgaaaatttt",
" agcctccgatgtaagtcatagctgtaactattacctgccacccctattacatcttacgtccatataca",
" ctgttatacaacgcgtcatggcggggtatgcgttttggtcgtcgtacgctcgatcgttaccgtacggc"),
Array(
" 2 columns mutants",
" cctgatagacgctatctggctatccaggtacttaggtcctctgtgcgaatctatgcgtttccaaccat",
" agtactggtgtacatttgatccatacgtacaccggcaacctgaaacaaacgctcagaaccagaagtgc",
" aaacgttagtgcaccctctttcttcgtggctctggccaacgagggctgatgtataagacgaaaattttt",
" agcctccgatgtaagtcatagctgtaactattacctgccacccctattacatcttacgtccatataca",
" ctgttatacaacgcgtcatggcggggtatgcgttttggtcgtcgtacgctcgatcgttaccgtacggc"),
Array(
" 2 columns mutants",
" cctgatagacgctatctggctatccaggtacttaggtcctctgtgcgaatctatgcgtttccaaccat",
" agtactggtgtacatttgatccatacgtacaccggcaacctgaaacaaacgctcagaaccagaagtgc",
" aaacgttagtgcaccctctttcttcgtggctctggccaacgagggctgatgtataagacgaaaattttt",
" agcctccgatgtaagtcatagctgtaactattacctgccacccctattacatcttacgtccatataca",
" ctgttatacaacgcgtcatggcggggtatgcgttttggtcgtcgtacgctcgatcgttaccgtacggc"),
Array(
" 2 columns mutants",
" cctgatagacgctatctggctatccaggtacttaggtcctctgtgcgaatctatgcgtttccaaccat",
" agtactggtgtacatttgatccatacgtacaccggcaacctgaaacaaacgctcagaaccagaagtgc",
" aaacgttagtgcaccctctttcttcgtggctctggccaacgagggctgatgtataagacgaaaattttt",
" agcctccgatgtaagtcatagctgtaactattacctgccacccctattacatcttacgtccatataca",
" ctgttatacaacgcgtcatggcggggtatgcgttttggtcgtcgtacgctcgatcgttaccgtacggc"))
var k: Int = 0
var m: Int = 0
var n: Int = 0
var bestScore: Int = 0
var optScore: Int = 0
var get: Int = 0
var ok1: Boolean = false
var ok3: Boolean = false
ok1 = false
ok3 = false
j = 1
lmer = 8
m = 1
t = 5
n = 69
optScore = 0
bestScore = 0
k = java.lang.Integer.parseInt(args(0))
j = 1
while (j <= t) {
seq(j) = new String()
i = 0
while (i < n) {
seq(j) += seq0(k)(j).charAt(i)
i += 1
}
j += 1
}
j = 1
while (j <= t) {
newPickup(1, j)
j += 1
}
j = 0
bestScore = 0
i = 1
val whilebreaker = new Breaks
whilebreaker.breakable {
while (i > 0) {
if (i < t) {
if (startPos(1) == (n - lmer)) whilebreaker.break
val sc = Score()
optScore = sc + (t - i) * lmer
if (optScore < bestScore) {
ok1 = false
j = i
val whilebreak1 = new Breaks
whilebreak1.breakable {
while (j >= 1) {
if (startPos(j) < n - lmer) {
ok1 = true
newPickup(0, j)
whilebreak1.break
} else {
ok1 = true
newPickup(1, j)
val whilebreak2 = new Breaks
whilebreak2.breakable {
while (startPos(i - 1) == (n - lmer)) {
newPickup(1, i - 1)
i -= 1
if (i == 0) whilebreak2.break
}
}
if (i > 1) {
newPickup(0, i - 1)
i -= 1
}
whilebreak1.break
}
}
}
if (ok1 == false) i = 0
} else {
newPickup(1, i + 1)
i += 1
}
} else {
get = Score()
if (get > bestScore) {
bestScore = get
m = 1
while (m <= t) {
bestMotif(m) = startPos(m)
m += 1
}
}
ok3 = false
j = t
val whilebreak3 = new Breaks
whilebreak3.breakable {
while (j >= 1) {
if (startPos(j) < n - lmer) {
ok3 = true
newPickup(0, j)
whilebreak3.break
} else {
ok3 = true
newPickup(1, j)
val whilebreak4 = new Breaks
whilebreak4.breakable {
while (startPos(i - 1) == (n - lmer)) {
newPickup(1, i - 1)
i -= 1
if (i == 0) whilebreak4.break
}
}
if (i > 1) {
newPickup(0, i - 1)
i -= 1
}
whilebreak3.break
}
}
}
if (ok3 == false) i = 0
}
}
}
println("Motiv: " + Consensus())
// println()
j = 1
while (j <= t) {
t2 = System.currentTimeMillis()
j += 1
}
println("time= " + (t2 - t1) + " ms")
}
def Score(): Int = {
var j: Int = 0
var k: Int = 0
var m: Int = 0
var max: Int = 0
var sum: Int = 0
sum = 0
max = 0
m = 1
while (m <= lmer) {
k = 1
while (k <= 4) {
ScoreMatrix(k)(m) = 0
k += 1
}
m += 1
}
m = 1
while (m <= lmer) {
k = 1
while (k <= i) pickup(k).charAt(m) match {
case 'a' => ScoreMatrix(1)(m) += 1
case 'c' => ScoreMatrix(2)(m) += 1
case 'g' => ScoreMatrix(3)(m) += 1
case 't' => ScoreMatrix(4)(m) += 1
}
m += 1
}
j = 1
while (j <= lmer) {
max = 0
m = 1
while (m <= 4) {
if (ScoreMatrix(m)(j) > max) {
max = ScoreMatrix(m)(j)
}
m += 1
}
sum += max
j += 1
}
sum
}
def Consensus(): String = {
var i: Int = 0
var j: Int = 0
var k: Int = 0
var m: Int = 0
var max: Int = 0
var imax: Int = 0
var str: String = null
i = 1
while (i <= t) {
pickup(i) = " " +
seq(i).substring(bestMotif(i), bestMotif(i) + lmer)
i += 1
}
m = 1
while (m <= lmer) {
k = 1
while (k <= 4) {
ScoreMatrix(k)(m) = 0
k += 1
}
m += 1
}
m = 1
while (m <= lmer) {
k = 1
while (k <= t) pickup(k).charAt(m) match {
case 'a' => ScoreMatrix(1)(m) += 1
case 'c' => ScoreMatrix(2)(m) += 1
case 'g' => ScoreMatrix(3)(m) += 1
case 't' => ScoreMatrix(4)(m) += 1
}
m += 1
}
str = ""
imax = 0
j = 1
while (j <= lmer) {
max = 0
i = 1
while (i <= 4) {
if (ScoreMatrix(i)(j) > max) {
max = ScoreMatrix(i)(j)
imax = i
}
i += 1
}
imax match {
case 1 => str += 'a'
case 2 => str += 'c'
case 3 => str += 'g'
case 4 => str += 't'
}
j += 1
}
str
}
def newPickup(one: Int, h: Int) {
if (one == 1) startPos(h) = 1 else startPos(h) += 1
pickup(h) = " " + seq(h).substring(startPos(h), startPos(h) + lmer)
}
}
and thanks, i hope someone gonna find my failure.

Answer 1

Your current implementation 'hangs' on this loop:
while (k <= i) pickup(k).charAt(m) match {
case 'a' => ScoreMatrix(1)(m) += 1
case 'c' => ScoreMatrix(2)(m) += 1
case 'g' => ScoreMatrix(3)(m) += 1
case 't' => ScoreMatrix(4)(m) += 1
}
As it stands, the exit condition is never fulfilled because the relation between k and i never changes. Either increment k or decrement i.
It looks like programming is not the key aspect of this work, but increased modularity should help contain complexity.
Also, I wonder about the choice of using Scala. There're many areas in this algorithm that would benefit of a more functional approach. In this translation, using Scala in an imperative way gets cumbersome. If you have the opportunity, I'd recommend you to explore a more functional approach to solve this problem.
A tip: The intellij debugger didn't have issues with this code.