I have the following java code:
for (int i = 0, j = 0; i < 10 && j < 10 0; i++, j++)
{
System.out.println("i = " + i + " :: " + "j = " + j);
}
The output is :
i = 0 :: j = 0
i = 1 :: j = 1
i = 2 :: j = 2
i = 3 :: j = 3
i = 4 :: j = 4
i = 5 :: j = 5
....
I would like to do the same thing in scala, I tried this but it does not work:
for (i<- 0 to 9; j <- 0 to 9)
{
println("i = " + i + " :: " + "j = " + j)
}
The output is:
i = 0 :: j = 0
i = 0 :: j = 1
i = 0 :: j = 2
i = 0 :: j = 3
i = 0 :: j = 4
i = 0 :: j = 5
i = 0 :: j = 6
i = 0 :: j = 7
i = 0 :: j = 8
i = 0 :: j = 9
i = 1 :: j = 0
i = 1 :: j = 1
i = 1 :: j = 2
i = 1 :: j = 3
....
I have not find a way to have two variables in the same level.
Thank you for your answer.
Scala's replacement would be
for {
(i, j) <- (0 to 9) zip (0 to 9)
} {
println("i = " + i + " :: " + "j = " + j)
}
To avoid the confusion I suggest reading what for is the syntactic sugar for (as opposed to Java it is not specialized while).
Since both variables always have the same value, you actually only need one of them. In Scala, you would generally not use a loop to solve this problem, but use higher-level collection operations instead. Something like:
(0 to 9) map { i => s"i = $i :: j = $i" } mkString "\n"
Note: this will only generate the string that you want to print, but not actually print it. It is generally considered a good thing to not mix generating data and printing data.
If you want to print this, you only need to pass it to println:
println((0 to 9) map { i => s"i = $i :: j = $i" } mkString "\n")
Or, in Scala 2.13+:
import scala.util.chaining._
(0 to 9) map { i => s"i = $i :: j = $i" } mkString "\n" pipe println
You could also write it like this:
(for (i <- 0 to 9) yield s"i = $i :: j = $i") mkString "\n"
Now, you might say, "Wait a minute, didn't you just say that we don't use loops in Scala?" Well, here's the thing: that's not a loop! That is a for comprehension. It is actually syntactic sugar for collection operations.
for (foo <- bar) yield baz(foo)
is actually just syntactic sugar for
bar map { foo => baz(foo) }
A for comprehension simply desugars into calls to map, flatMap, foreach, and withFilter. It is not a loop.
Note that Scala does have a while loop. It exists mainly for performance reasons. Unless you are writing low-level libraries that are going to be used in performance-intensive code by tens of thousands of developers, please just pretend that it doesn't exist.
Also note that if the while loop weren't built into Scala, you could easily write it yourself:
def whiley(cond: => Boolean)(body: => Unit): Unit =
if (cond) { body; whiley(cond)(body) }
you can do it as below
val start = 0; val size = 10;
for ((i, j) <- (start to size) zip (start to size))
{
println(s"i=$i j=$j")
}
j is just a copy of i so this is one solution:
for {
i <- 0 to 9
j = i
} {
println("i = " + i + " :: " + "j = " + j)
}
This pattern works in any situation where j is just a function of i
Related
Write a program in Scala that reads an String from the keyboard and counts the number of characters, ignoring if its UpperCase or LowerCase
ex: Avocado
R: A = 2; v = 1; o = 2; c = 1; d = 2;
So, i tried to do it with two fors iterating over the string, and then a conditional to transform the character in the position (x) to Upper and compare with the character in the position (y) which is the same position... basically i'm transforming the same character so i can increment in the counter ex: Ava -> A = 2; v = 1;
But with this logic when i print the result it comes with:
ex: Avocado
R: A = 2; v = 1; o = 2; c = 1; a = 2; d = 1; o = 2;
its repeting the same character Upper or Lower in the result...
so my teacher asked us to resolve this using the split method and yield of Scala but i dunno how to use the split without forEach() that he doesnt allow us to use.
sorry for the bad english
object ex8 {
def main(args: Array[String]): Unit = {
println("Write a string")
var string = readLine()
var cont = 0
for (x <- 0 to string.length - 1) {
for (y <- 0 to string.length - 1) {
if (string.charAt(x).toUpper == string.charAt(y).toUpper)
cont += 1
}
print(string.charAt(x) + " = " + cont + "; ")
cont = 0
}
}
}
But with this logic when i print the result it comes with:
ex: Avocado
R: A = 2; V = 1; o = 2; c = 1; a = 2; d = 1; o = 2;
Scala 2.13 has added a very handy method to cover this sort of thing.
inputStr.groupMapReduce(_.toUpper)(_ => 1)(_+_)
.foreach{case (k,v) => println(s"$k = $v")}
//A = 2
//V = 1
//C = 1
//O = 2
//D = 1
It might be easier to group the individual elements of the String (i.e. a collection of Chars, made case-insensitive with toLower) to aggregate their corresponding size using groupBy/mapValues:
"Avocado".groupBy(_.toLower).mapValues(_.size)
// res1: scala.collection.immutable.Map[Char,Int] =
// Map(a -> 2, v -> 1, c -> 1, o -> 2, d -> 1)
Scala 2.11
Tried with classic word count approach of map => group => reduce
val exampleStr = "Avocado R"
exampleStr.
toLowerCase.
trim.
replaceAll(" +","").
toCharArray.map(x => (x,1)).groupBy(_._1).
map(x => (x._1,x._2.length))
Answer :
exampleStr: String = Avocado R
res3: scala.collection.immutable.Map[Char,Int] =
Map(a -> 2, v -> 1, c -> 1, r -> 1, o -> 2, d -> 1)
Can "foreach" can be used for each element of the 2-D List/Array?
I tried the code:
val n_vec = (0 to 2).map(i=>
(0 to 2).map(j=>
Wire(UInt(3.W))
)
)
n_vec.foreach((i:Int)=>(
n_vec(i).foreach((j:Int)=>{
n_vec(i)(j) := i.U + j.U
})
))
the error message is
top.scala:24: error: type mismatch;
found : Int => Unit
required: chisel3.core.UInt => ?
n_vec(i).foreach((j:Int)=>{
^
Could you enlight me whether it can be used in such a way, even how?
It would be cleaner to write like this:
n_vec.foreach { i=>
i.foreach { j=>
j := x.U + y.U
y = y + 1
}
y = 0
x = x + 1
}
But you don't need to increment x and y manually, just iterate over indices instead:
n_vec.indices.foreach { x =>
n_vec(x).indices.foreach { y =>
n_vec(x)(y) := x.U + y.U
}
}
or better (and this translates exactly to the above)
for {
x <- n_vec.indices
y <- n_vec(x).indices
} {
n_vec(x)(y) := x.U + y.U
}
Yes it can be used this way.
solution:
var x = 0
var y = 0
n_vec.foreach(i=>{
i.foreach(j=>{
j := x.U + y.U
y = y + 1
})
y = 0
x = x + 1
})
x = 0
y = 0
Below code searches for a motif (of length 8) in a sequence(String) and, as the result, it has to give back sequence with the best score. The problem is, although the code produces no errors, there is no output at all (probably infinite cycle, I observe blank console).
I am gonna give all my code online and if that is required. In order to reproduce the problem, just pass a number (between 0 and 3 - you can give 4 sequence, so you must choose 1 of them 0 is the first , 1 is the second etc) as args(0) (e.g. "0"), expected output should look something like "Motif = ctgatgta"
import scala.util.control._
object BranchAndBound {
var seq: Array[String] = new Array[String](20)
var startPos: Array[Int] = new Array[Int](20)
var pickup: Array[String] = new Array[String](20)
var bestMotif: Array[Int] = new Array[Int](20)
var ScoreMatrix = Array.ofDim[Int](5, 20)
var i: Int = _
var j: Int = _
var lmer: Int = _
var t: Int = _
def main(args: Array[String]) {
var t1: Long = 0
var t2: Long = 0
t1 = 0
t2 = 0
t1 = System.currentTimeMillis()
val seq0 = Array(
Array(
" >5 regulatory reagions with 69 bp",
" cctgatagacgctatctggctatccaggtacttaggtcctctgtgcgaatctatgcgtttccaaccat",
" agtactggtgtacatttgatccatacgtacaccggcaacctgaaacaaacgctcagaaccagaagtgc",
" aaacgttagtgcaccctctttcttcgtggctctggccaacgagggctgatgtataagacgaaaatttt",
" agcctccgatgtaagtcatagctgtaactattacctgccacccctattacatcttacgtccatataca",
" ctgttatacaacgcgtcatggcggggtatgcgttttggtcgtcgtacgctcgatcgttaccgtacggc"),
Array(
" 2 columns mutants",
" cctgatagacgctatctggctatccaggtacttaggtcctctgtgcgaatctatgcgtttccaaccat",
" agtactggtgtacatttgatccatacgtacaccggcaacctgaaacaaacgctcagaaccagaagtgc",
" aaacgttagtgcaccctctttcttcgtggctctggccaacgagggctgatgtataagacgaaaattttt",
" agcctccgatgtaagtcatagctgtaactattacctgccacccctattacatcttacgtccatataca",
" ctgttatacaacgcgtcatggcggggtatgcgttttggtcgtcgtacgctcgatcgttaccgtacggc"),
Array(
" 2 columns mutants",
" cctgatagacgctatctggctatccaggtacttaggtcctctgtgcgaatctatgcgtttccaaccat",
" agtactggtgtacatttgatccatacgtacaccggcaacctgaaacaaacgctcagaaccagaagtgc",
" aaacgttagtgcaccctctttcttcgtggctctggccaacgagggctgatgtataagacgaaaattttt",
" agcctccgatgtaagtcatagctgtaactattacctgccacccctattacatcttacgtccatataca",
" ctgttatacaacgcgtcatggcggggtatgcgttttggtcgtcgtacgctcgatcgttaccgtacggc"),
Array(
" 2 columns mutants",
" cctgatagacgctatctggctatccaggtacttaggtcctctgtgcgaatctatgcgtttccaaccat",
" agtactggtgtacatttgatccatacgtacaccggcaacctgaaacaaacgctcagaaccagaagtgc",
" aaacgttagtgcaccctctttcttcgtggctctggccaacgagggctgatgtataagacgaaaattttt",
" agcctccgatgtaagtcatagctgtaactattacctgccacccctattacatcttacgtccatataca",
" ctgttatacaacgcgtcatggcggggtatgcgttttggtcgtcgtacgctcgatcgttaccgtacggc"))
var k: Int = 0
var m: Int = 0
var n: Int = 0
var bestScore: Int = 0
var optScore: Int = 0
var get: Int = 0
var ok1: Boolean = false
var ok3: Boolean = false
ok1 = false
ok3 = false
j = 1
lmer = 8
m = 1
t = 5
n = 69
optScore = 0
bestScore = 0
k = java.lang.Integer.parseInt(args(0))
j = 1
while (j <= t) {
seq(j) = new String()
i = 0
while (i < n) {
seq(j) += seq0(k)(j).charAt(i)
i += 1
}
j += 1
}
j = 1
while (j <= t) {
newPickup(1, j)
j += 1
}
j = 0
bestScore = 0
i = 1
val whilebreaker = new Breaks
whilebreaker.breakable {
while (i > 0) {
if (i < t) {
if (startPos(1) == (n - lmer)) whilebreaker.break
val sc = Score()
optScore = sc + (t - i) * lmer
if (optScore < bestScore) {
ok1 = false
j = i
val whilebreak1 = new Breaks
whilebreak1.breakable {
while (j >= 1) {
if (startPos(j) < n - lmer) {
ok1 = true
newPickup(0, j)
whilebreak1.break
} else {
ok1 = true
newPickup(1, j)
val whilebreak2 = new Breaks
whilebreak2.breakable {
while (startPos(i - 1) == (n - lmer)) {
newPickup(1, i - 1)
i -= 1
if (i == 0) whilebreak2.break
}
}
if (i > 1) {
newPickup(0, i - 1)
i -= 1
}
whilebreak1.break
}
}
}
if (ok1 == false) i = 0
} else {
newPickup(1, i + 1)
i += 1
}
} else {
get = Score()
if (get > bestScore) {
bestScore = get
m = 1
while (m <= t) {
bestMotif(m) = startPos(m)
m += 1
}
}
ok3 = false
j = t
val whilebreak3 = new Breaks
whilebreak3.breakable {
while (j >= 1) {
if (startPos(j) < n - lmer) {
ok3 = true
newPickup(0, j)
whilebreak3.break
} else {
ok3 = true
newPickup(1, j)
val whilebreak4 = new Breaks
whilebreak4.breakable {
while (startPos(i - 1) == (n - lmer)) {
newPickup(1, i - 1)
i -= 1
if (i == 0) whilebreak4.break
}
}
if (i > 1) {
newPickup(0, i - 1)
i -= 1
}
whilebreak3.break
}
}
}
if (ok3 == false) i = 0
}
}
}
println("Motiv: " + Consensus())
// println()
j = 1
while (j <= t) {
t2 = System.currentTimeMillis()
j += 1
}
println("time= " + (t2 - t1) + " ms")
}
def Score(): Int = {
var j: Int = 0
var k: Int = 0
var m: Int = 0
var max: Int = 0
var sum: Int = 0
sum = 0
max = 0
m = 1
while (m <= lmer) {
k = 1
while (k <= 4) {
ScoreMatrix(k)(m) = 0
k += 1
}
m += 1
}
m = 1
while (m <= lmer) {
k = 1
while (k <= i) pickup(k).charAt(m) match {
case 'a' => ScoreMatrix(1)(m) += 1
case 'c' => ScoreMatrix(2)(m) += 1
case 'g' => ScoreMatrix(3)(m) += 1
case 't' => ScoreMatrix(4)(m) += 1
}
m += 1
}
j = 1
while (j <= lmer) {
max = 0
m = 1
while (m <= 4) {
if (ScoreMatrix(m)(j) > max) {
max = ScoreMatrix(m)(j)
}
m += 1
}
sum += max
j += 1
}
sum
}
def Consensus(): String = {
var i: Int = 0
var j: Int = 0
var k: Int = 0
var m: Int = 0
var max: Int = 0
var imax: Int = 0
var str: String = null
i = 1
while (i <= t) {
pickup(i) = " " +
seq(i).substring(bestMotif(i), bestMotif(i) + lmer)
i += 1
}
m = 1
while (m <= lmer) {
k = 1
while (k <= 4) {
ScoreMatrix(k)(m) = 0
k += 1
}
m += 1
}
m = 1
while (m <= lmer) {
k = 1
while (k <= t) pickup(k).charAt(m) match {
case 'a' => ScoreMatrix(1)(m) += 1
case 'c' => ScoreMatrix(2)(m) += 1
case 'g' => ScoreMatrix(3)(m) += 1
case 't' => ScoreMatrix(4)(m) += 1
}
m += 1
}
str = ""
imax = 0
j = 1
while (j <= lmer) {
max = 0
i = 1
while (i <= 4) {
if (ScoreMatrix(i)(j) > max) {
max = ScoreMatrix(i)(j)
imax = i
}
i += 1
}
imax match {
case 1 => str += 'a'
case 2 => str += 'c'
case 3 => str += 'g'
case 4 => str += 't'
}
j += 1
}
str
}
def newPickup(one: Int, h: Int) {
if (one == 1) startPos(h) = 1 else startPos(h) += 1
pickup(h) = " " + seq(h).substring(startPos(h), startPos(h) + lmer)
}
}
and thanks, i hope someone gonna find my failure.
Your current implementation 'hangs' on this loop:
while (k <= i) pickup(k).charAt(m) match {
case 'a' => ScoreMatrix(1)(m) += 1
case 'c' => ScoreMatrix(2)(m) += 1
case 'g' => ScoreMatrix(3)(m) += 1
case 't' => ScoreMatrix(4)(m) += 1
}
As it stands, the exit condition is never fulfilled because the relation between k and i never changes. Either increment k or decrement i.
It looks like programming is not the key aspect of this work, but increased modularity should help contain complexity.
Also, I wonder about the choice of using Scala. There're many areas in this algorithm that would benefit of a more functional approach. In this translation, using Scala in an imperative way gets cumbersome. If you have the opportunity, I'd recommend you to explore a more functional approach to solve this problem.
A tip: The intellij debugger didn't have issues with this code.
I have just started learning Scala and sideways I am doing some algorithms also. Below is an implementation of merge sort in Scala. I know it isn't very "scala" in nature, and some might even reckon that I have tried to write java in scala. I am not totally familiar with scala, i just know some basic syntax and i keep googling if i need something more. So please give me some pointers on to what can i do in this code to make it more functional and in accord with scala conventions and best practices. Please dont just give correct/optimized code, i will like to do it myself. Any suggestions are welcomed !
def mergeSort(list: Array[Int]): Array[Int] = {
val len = list.length
if (len == 1) list
else {
var x, y = new Array[Int](len / 2)
val z = new Array[Int](len)
Array.copy(list, 0, x, 0, len / 2)
Array.copy(list, len / 2, y, 0, len / 2)
x = mergeSort(x)
y = mergeSort(y)
var i, j = 0
for (k <- 0 until len) {
if (j >= y.length || (i < x.length && x(i) < y(j))) {
z(k) = x(i)
i = i + 1
} else {
z(k) = y(j)
j = j + 1
}
}
z
}
}
[EDIT]
This code works fine and I have assumed for now that input array will always be of even length.
UPDATE
Removed vars x and y
def mergeSort(list: Array[Int]): Array[Int] = {
val len = list.length
if (len == 1) list
else {
val z = new Array[Int](len)
val x = mergeSort(list.dropRight(len/2))
val y = mergeSort(list.drop(len/2))
var i, j = 0
for (k <- 0 until len) {
if (j >= y.length || (i < x.length && x(i) < y(j))) {
z(k) = x(i)
i = i + 1
} else {
z(k) = y(j)
j = j + 1
}
}
z
}
}
Removing the var x,y = ... would be a good start to being functional. Prefer immutability to mutable datasets.
HINT: a method swap that takes two values and returns them ordered using a predicate
Also consider removing the for loop(or comprehension).
I have a 3d array defined like so:
val 3dArray = new Array[Array[Array[Int]]](512, 8, 8)
In Javascript I would do the following to assign each element to 1:
for (i = 0; i < 512; i++)
{
3dArray[i] = [];
for (j = 0; j < 8; j++)
{
3dArray[i][j] = [];
for (k = 0; k < 8; k++)
{
3dArray[i][j][k] = 1;
}
}
}
What's the most elegant approach to doing the same?
Not sure there's a particularly elegant way to do it, but here's one way (I use suffix s to indicate dimension, i.e. xss is a two-dimensional array).
val xsss = Array.ofDim[Int](512, 8, 8)
for (xss <- xsss; xs <- xss; i <- 0 until 8)
xs(i) = 1
Or, using transform it gets even shorter:
for (xss <- xsss; xs <- xss)
xs transform (_ => 1)
for {
i <- a.indices
j <- a(i).indices
k <- a(i)(j).indices
} a(i)(j)(k) = 1
or
for {
e <- a
ee <- e
i <- ee.indices
} ee(i) = 1
See: http://www.scala-lang.org/api/current/index.html#scala.Array$
You have Array.fill to initialize an array of 1 to 5 dimension to some given value, and Array.tabulate to initialize an array of 1 to 5 dimension given the current indexes:
scala> Array.fill(2,1,1)(42)
res1: Array[Array[Array[Int]]] = Array(Array(Array(42)), Array(Array(42)))
enter code here
scala> Array.tabulate(3,2,1){ (x,y,z) => x+y+z }
res2: Array[Array[Array[Int]]] = Array(Array(Array(0), Array(1)), Array(Array(1), Array(2)), Array(Array(2), Array(3)))