Use grep to select certain words with special characters - sed

I have a file that looks like this:
chr4 StringTie exon 185054979 185055237 1000 + . gene_id `"MSTRG.41311"; transcript_id "ENST00000658673.1"; exon_number "2"; gene_name `"LINC02436"; ref_gene_id "ENSG00000250754.6";
chr4 StringTie exon 185069961 185070030 1000 + . gene_id `"MSTRG.41311"; transcript_id "ENST00000658673.1"; exon_number "3"; gene_name "LINC02436"; ref_gene_id "ENSG00000250754.6";
chr6 HAVANA exon 169067764 169068299 . + . gene_id "ENSG00000234519.2"; transcript_id "ENST00000666733.1"; exon_number "1"; gene_name "RP3-495K2.1";
I want to only keep the gene id information so the file will look like this:
MSTRG.41311
MSTRG.41311
ENSG00000234519.2
I have tried the following:
cat file.gtf|sed 's/!ENSG*//g'|sed 's/!ENSG*//g' > myfile.txt.
But this does not give me the desired output. I think this is because of the quotation marks which is a special character but I'm not sure.
Can someone help with this problem?
Thanks!

Try with this (GNU sed):
sed -E 's/gene_id/\x0/;s/.*\x0 `?"([^"]+)".*/\1/' input
Since gene_id occurs twice on the first two lines (and you seem to be intereseted in the first occurrence on each line), I can't just go with sed 's/.*gene_id…, otherwise the .* will eat everything up to the before the last gene_id on the line.
Therefore, my approach is to pick the first gene_id on each line and change it in a \x0 character, via s/gene_id/\x0/ (since there's no greedy .* before gene_id, it will match the first on the line).
Once I've marked that position with \x0, I can use it to "anchor" the rest of the regex in the following substitution, where .*\x0 will match everything on each line up to and including (what was) the first gene_id on the line, and `?"([^"]+)".* matches the rest of the line while capturing with (…) the part between "s.
I've used -E for extended regex, so I can use (…) instead of \(…\), for instance.
Oh, the `? is just because you've put those backticks in the first two lines, so with ? (which'd be \? without the -E option) I required that zero or one backtick matches at that position. Not sure if it was a copy and paste mistake.

This might work for you (GNU sed):
sed -En 's/.*\<gene_id\>[^"]*"([^"]*)".*/\1/p' file
Turn on extended regexp -E and off implicit printing -n as this is a filtering operation.
Match the word gene_id, make a back reference to the string between the next pair of double quotes and replace the whole line by the back reference printing the result.

Fast:
awk -v RS='[^[:alnum:]_.]+' 'f==1{print;f=0} $0=="gene_id"{f=1}'
100% POSIX:
awk -F '[^[:alnum:]_.]+' '{for (i=1; i<=NF; i++) {if ($i=="gene_id") {print $(i+1); next}}}'
Setting RS to a regular expression is not posix, but is commonly available.
You could adapt either to print any field, anywhere in the line.

You can also try do this with cut -d"delimiter" -f columns nb
For example :
cat file.gtf | cat f.txt | cut -d"\"" -f 1
The \ is use because " can't be place between two others " "

Related

GREP Print Blank Lines For Non-Matches

I want to extract strings between two patterns with GREP, but when no match is found, I would like to print a blank line instead.
Input
This is very new
This is quite old
This is not so new
Desired Output
is very
is not so
I've attempted:
grep -o -P '(?<=This).*?(?=new)'
But this does not preserve the second blank line in the above example. Have searched for over an hour, tried a few things but nothing's worked out.
Will happily used a solution in SED if that's easier!
You can use
#!/bin/bash
s='This is very new
This is quite old
This is not so new'
sed -En 's/.*This(.*)new.*|.*/\1/p' <<< "$s"
See the online demo yielding
is very
is not so
Details:
E - enables POSIX ERE regex syntax
n - suppresses default line output
s/.*This(.*)new.*|.*/\1/ - finds any text, This, any text (captured into Group 1, \1, and then any text again, or the whole string (in sed, line), and replaces with Group 1 value.
p - prints the result of the substitution.
And this is what you need for your actual data:
sed -En 's/.*"user_ip":"([^"]*).*|.*/\1/p'
See this online demo. The [^"]* matches zero or more chars other than a " char.
With your shown samples, please try following awk code.
awk -F'This\\s+|\\s+new' 'NF==3{print $2;next} NF!=3{print ""}' Input_file
OR
awk -F'This\\s+|\\s+new' 'NF==3{print $2;next} {print ""}' Input_file
Explanation: Simple explanation would be, setting This\\s+ OR \\s+new as field separators for all the lines of Input_file. Then in main program checking condition if NF(number of fields) are 3 then print 2nd field (where next will take cursor to next line). In another condition checking if NF(number of fields) is NOT equal to 3 then simply print a blank line.
sed:
sed -E '
/This.*new/! s/.*//
s/.*This(.*)new.*/\1/
' file
first line: lines not matching "This.*new", remove all characters leaving a blank line
second lnie: lines matching the pattern, keep only the "middle" text
this is not the pcre non-greedy match: the line
This is new but that is not new
will produce the output
is new but that is not
To continue to use PCRE, use perl:
perl -lpe '$_ = /This(.*?)new/ ? $1 : ""' file
This might work for you:
sed -E 's/.*This(.*)new.*|.*/\1/' file
If the first match is made, the line is replace by everything between This and new.
Otherwise the second match will remove everything.
N.B. The substitution will always match one of the conditions. The solution was suggested by Wiktor Stribiżew.

Match path prefix and replace all delimiters

I would like to match a path prefix and replace all delimiters using sed.
Consider the following example strings and the desired results. The path prefix is one/two and the delimiter is forward slash.
one/two/three.Something => one.two.three.Something
one/two/three/four/five.Another => one.two.three.four.five.Another
So far I've come up with this command
echo one/two/three.Something | sed 's/one\/two\(.*\)\./one.two\1./g'
How do I make it produce the results above, can this be done with sed?
Could you please try following.
awk '/one\/two.*Something||\/one\/two.*Another/{gsub(/\//,".")} 1' Input_file
This will look for string one/two till either something or Another and replace all / with . in that line.
Explanation: Adding detailed level explanation for above code.
awk ' ##Starting awk program from here.
/one\/two.*Something||\/one\/two.*Another/{ ##Checking condition if a line has one/two till Something OR one/two till Another then do following.
gsub(/\//,".") ##Using global substitution to substitute all / with DOT
}
1 ##Mentioning 1 will print edited/non-edited lines here.
' Input_file ##Mentioning Input_file name here.
With GNU sed, you may use
sed ':a; s~^\(one\)[/.]\(two[^.]*\)/~\1.\2.~; ta;' file;
One caveat: it will also match one.two prefixed lines.
Or, you may also use
sed 's/^one\/two[^.]*/&\n/;h;y/\//./;G;s/\n.*\n//' file
This correctly handles only one/two prefixed lines.
The first sed command means:
:a - sets an a label
s~^\(one\)[/.]\(two[^.]*\)/~\1.\2.~ - finds the following:
^ - start of string
\(one\) - Group 1 (\1): one word
[/.] - a / or .
\(two[^.]*\) - Group 2: two, then 0+ chars other than . and then
/ - a / char
\1.\2. - Replaces with Group 1 value + . + Group 2 value + .
ta - loop to :a label if there was a match at the preceding iteration.
The second sed command means
s/^one\/two[^.]*/&\n/ - replace one/two + 0 or more chars other than . with the same value (&) and append a newline
h - copies the pattern buffer into the hold buffer while keeping the pattern buffer unchanged
y/\//./ - replaces each / with .
G - append hold space to the pattern space
s/\n.*\n// - remove the redundant text between two introduced newlines.
See the online sed demo:
tests="one/two/three.Something one/two/three/four/five.Another"
for test in $tests; do
sed ':a; s~^\(one\)[/.]\(two[^.]*\)/~\1.\2.~; ta;' <<< "$test";
sed 's/^one\/two[^.]*/&\n/;h;y/\//./;G;s/\n.*\n//' <<< "$test"
done;
Output:
one.two.three.Something
one.two.three.four.five.Another
This might work for you (GNU sed):
sed 's#one/two/\S\+#echo "&"|sed "s:/:.:g"#eg' file
This solution calls a second invocation of sed within the RHS of a substitution. The first substitution extracts the path, the second echo's that result into another invocation of sed that replaces the /'s with .'s.
N.B. The substitutions can be applied globally throughout the file.

Select only a part of string ("name=number" ) with sed

I have something like
chr1 162724289 162724421 CAAAATGTTTATAAGGACAGCCTGCTCTCTCCCCTCAGTACAGGGCAGCTGCTTGCCTGTGAACCAGTAAACAGCTCTGTGGTTTCATGGTTGCTCCCTCTCTCCCCAACCCTCACCTCTCAAGGCTGGACT chr1 162724414 162724421 ID=exon:ENST00000367921.3:5;Parent=ENST00000367921.3;gene_id=ENSG00000162733.12;transcript_id=ENST00000367921.3;gene_type=protein_coding;gene_status=KNOWN;gene_name=DDR2;transcript_type=protein_coding;transcript_status=KNOWN;transcript_name=DDR2-002;exon_number=5;exon_id=ENSE00001165686.1;level=2;protein_id=ENSP00000356898.3;ccdsid=CCDS1241.1;havana_gene=OTTHUMG00000034423.4;havana_transcript=OTTHUMT00000097650.1;tag=basic,appris_principal,CCDS
I would like to extract only the exon_number=5 from the 8th column. This is kind of a long one line command and, since I have other columns I want to keep, I guess that I cannot use awk -F ';'. I tried something like:
sed -E 's/ ID=*\(exon_number=[0-9]\)* \1/'
Desired output:
chr1 162724289 162724421 CAAAATGTTTATAAGGACAGCCTGCTCTCTCCCCTCAGTACAGGGCAGCTGCTTGCCTGTGAACCAGTAAACAGCTCTGTGGTTTCATGGTTGCTCCCTCTCTCCCCAACCCTCACCTCTCAAGGCTGGACT chr1 162724414 162724421 exon_number=5
Any advice would be great!
Thanks
With sed, you may match and remove exactly what you want:
sed -E 's/(.* )ID=[^[:space:]]*(exon_number=[0-9]+).*/\1\2/'
See the online sed demo
Explanation
-E - POSIX ERE syntax enabling option
(.* )ID=[^[:space:]]*(exon_number=[0-9]+).* - a rege pattern matching:
(.* ) - Group 1: any 0+ chars, as many as possible, and then a space
ID=[^[:space:]]* - ID= and 0+ whitespace chars
(exon_number=[0-9]+) - exon_number= and 1 or more digits (Group 2)
.* - the rest of the line
\1\2 - the replacement pattern inserts the contents of Group 1 and 2 into the resulting string.
EDIT: As per OP changed the requirement so putting solution as per that only.
awk -F";" 'match($0,/exon_number=[0-9]+/){val=$1;sub(/ ID.*/,"",val);print val,substr($0,RSTART,RLENGTH)}' Input_file
Following simple awk may help you here.
awk 'match($0,/exon_number=[0-9]+/){print substr($0,RSTART,RLENGTH)}' Input_file
Solution 2nd: In case your Input_file is having always same kind of data then simply print it by field.
awk -F";" '{print $11}' Input_file

Using sed to swap columns X and X+1 inline in delimited file

I have a file with multiple lines and for line 2 to the end of the file I want to swap fields 8 and 9. The file is comma separated and I'd like to do the swap inline so I can run it on a batch of files using * wildcard. If this can be accomplished similarly with awk then that works for me too.
example:
header1,header2,header3,...,header8,header9,...,headerN
field1.1,...,field1.9,field1.8,...,field1.N
field2.1,...,field2.9,field2.8,...,field2.N
field3.1,...,field3.9,field3.8,...,field3.N
...
I think the command would look similar to sed -r -i '2,$s/^(([^,]*,){8})([^,]*,)([^,]*,)(.*)/\1\3\2\4/' temp*.log,
but \2 is not what I expect, it is the 7th field. I know that \2 will not be the 8th field because I have double parentheses there, but I'm not sure how to fix it. Could somebody please explain what this equation is doing and specifically what [^,] is doing and how the {8} is applied?
Thanks in advance.
In awk, you might use:
awk -F',' 'BEGIN {OFS=","} {t = $8; $8 = $9; $9 = t; print}'
In sed, the command is more convoluted, but it could be done.
sed -e 's/^\(\([^,]*,\)\{7\}\)\([^,]*,\)\([^,]*,\)/\1\4\3/'
Add the -i .bak option if your version of sed (e.g. GNU or BSD) supports it.
This uses the universally available sed regexes (it would work on even archaic versions of sed). You could lose most of the backslashes if you used 'extended regular expressions' instead:
sed -r -i 's/^(([^,]*,){7})([^,]*,)([^,]*,)/\1\4\3\5/'
Note the nested remembered (captured) patterns. The outer set is \1, the inner set would be \2 but that gets repeated 7 times, so you'd have the seventh field as \2. Anyway, that's why the eighth and ninth columns are switched with \4 and \3. \5 are the remaining columns.
(I note in passing that it would have been helpful to have some sample data in sufficiently the correct format to test with. It was a nuisance having to edit what is shown in the question to be able to test the code.)
If you need to do much CSV work, then either use Perl and its CSV modules (Text::CSV and Text::CSV_XS) or Python and its CSV module, or get CSVfix.
$2 is the second part in the RE
Denumbered by first occurence of (.
So in
'2,$s/^(([^,]*,){8})([^,]*,)([^,]*,)(.*)/\1\3\2\4/'
You could see (followind alignment):
$1 = (([^,]*,){8})
$2 = ([^,]*,)
$3 = ([^,]*,)
$4 = ([^,]*,)
and finaly $5 = (.*)
In this specific case, $2 must hold the last match of the height ({8}).
it seems that awk is the right tool:
awk -F',' -v OFS=',' '{t=$8;$8=$9;$9=t}7' file
This might work for you (GNU sed):
sed -ri '1!s/(,[^,]*)(,[^,]*)/\2\1/4' file
This swaps the 9th field with the 8th i.e. 8 / 2 = 4, if you wanted the 7th with the 8th:
sed -ri '1!{s/^/,/;s/(,[^,]*)(,[^,]*)/\2\1/4;s/^,//}' file

How can I replace each newline (\n) with a space using sed?

How can I replace a newline ("\n") with a space ("") using the sed command?
I unsuccessfully tried:
sed 's#\n# #g' file
sed 's#^$# #g' file
How do I fix it?
sed is intended to be used on line-based input. Although it can do what you need.
A better option here is to use the tr command as follows:
tr '\n' ' ' < input_filename
or remove the newline characters entirely:
tr -d '\n' < input.txt > output.txt
or if you have the GNU version (with its long options)
tr --delete '\n' < input.txt > output.txt
Use this solution with GNU sed:
sed ':a;N;$!ba;s/\n/ /g' file
This will read the whole file in a loop (':a;N;$!ba), then replaces the newline(s) with a space (s/\n/ /g). Additional substitutions can be simply appended if needed.
Explanation:
sed starts by reading the first line excluding the newline into the pattern space.
Create a label via :a.
Append a newline and next line to the pattern space via N.
If we are before the last line, branch to the created label $!ba ($! means not to do it on the last line. This is necessary to avoid executing N again, which would terminate the script if there is no more input!).
Finally the substitution replaces every newline with a space on the pattern space (which is the whole file).
Here is cross-platform compatible syntax which works with BSD and OS X's sed (as per #Benjie comment):
sed -e ':a' -e 'N' -e '$!ba' -e 's/\n/ /g' file
As you can see, using sed for this otherwise simple problem is problematic. For a simpler and adequate solution see this answer.
Fast answer
sed ':a;N;$!ba;s/\n/ /g' file
:a create a label 'a'
N append the next line to the pattern space
$! if not the last line, ba branch (go to) label 'a'
s substitute, /\n/ regex for new line, / / by a space, /g global match (as many times as it can)
sed will loop through step 1 to 3 until it reach the last line, getting all lines fit in the pattern space where sed will substitute all \n characters
Alternatives
All alternatives, unlike sed will not need to reach the last line to begin the process
with bash, slow
while read line; do printf "%s" "$line "; done < file
with perl, sed-like speed
perl -p -e 's/\n/ /' file
with tr, faster than sed, can replace by one character only
tr '\n' ' ' < file
with paste, tr-like speed, can replace by one character only
paste -s -d ' ' file
with awk, tr-like speed
awk 1 ORS=' ' file
Other alternative like "echo $(< file)" is slow, works only on small files and needs to process the whole file to begin the process.
Long answer from the sed FAQ 5.10
5.10. Why can't I match or delete a newline using the \n escape
sequence? Why can't I match 2 or more lines using \n?
The \n will never match the newline at the end-of-line because the
newline is always stripped off before the line is placed into the
pattern space. To get 2 or more lines into the pattern space, use
the 'N' command or something similar (such as 'H;...;g;').
Sed works like this: sed reads one line at a time, chops off the
terminating newline, puts what is left into the pattern space where
the sed script can address or change it, and when the pattern space
is printed, appends a newline to stdout (or to a file). If the
pattern space is entirely or partially deleted with 'd' or 'D', the
newline is not added in such cases. Thus, scripts like
sed 's/\n//' file # to delete newlines from each line
sed 's/\n/foo\n/' file # to add a word to the end of each line
will NEVER work, because the trailing newline is removed before
the line is put into the pattern space. To perform the above tasks,
use one of these scripts instead:
tr -d '\n' < file # use tr to delete newlines
sed ':a;N;$!ba;s/\n//g' file # GNU sed to delete newlines
sed 's/$/ foo/' file # add "foo" to end of each line
Since versions of sed other than GNU sed have limits to the size of
the pattern buffer, the Unix 'tr' utility is to be preferred here.
If the last line of the file contains a newline, GNU sed will add
that newline to the output but delete all others, whereas tr will
delete all newlines.
To match a block of two or more lines, there are 3 basic choices:
(1) use the 'N' command to add the Next line to the pattern space;
(2) use the 'H' command at least twice to append the current line
to the Hold space, and then retrieve the lines from the hold space
with x, g, or G; or (3) use address ranges (see section 3.3, above)
to match lines between two specified addresses.
Choices (1) and (2) will put an \n into the pattern space, where it
can be addressed as desired ('s/ABC\nXYZ/alphabet/g'). One example
of using 'N' to delete a block of lines appears in section 4.13
("How do I delete a block of specific consecutive lines?"). This
example can be modified by changing the delete command to something
else, like 'p' (print), 'i' (insert), 'c' (change), 'a' (append),
or 's' (substitute).
Choice (3) will not put an \n into the pattern space, but it does
match a block of consecutive lines, so it may be that you don't
even need the \n to find what you're looking for. Since GNU sed
version 3.02.80 now supports this syntax:
sed '/start/,+4d' # to delete "start" plus the next 4 lines,
in addition to the traditional '/from here/,/to there/{...}' range
addresses, it may be possible to avoid the use of \n entirely.
A shorter awk alternative:
awk 1 ORS=' '
Explanation
An awk program is built up of rules which consist of conditional code-blocks, i.e.:
condition { code-block }
If the code-block is omitted, the default is used: { print $0 }. Thus, the 1 is interpreted as a true condition and print $0 is executed for each line.
When awk reads the input it splits it into records based on the value of RS (Record Separator), which by default is a newline, thus awk will by default parse the input line-wise. The splitting also involves stripping off RS from the input record.
Now, when printing a record, ORS (Output Record Separator) is appended to it, default is again a newline. So by changing ORS to a space all newlines are changed to spaces.
GNU sed has an option, -z, for null-separated records (lines). You can just call:
sed -z 's/\n/ /g'
The Perl version works the way you expected.
perl -i -p -e 's/\n//' file
As pointed out in the comments, it's worth noting that this edits in place. -i.bak will give you a backup of the original file before the replacement in case your regular expression isn't as smart as you thought.
Who needs sed? Here is the bash way:
cat test.txt | while read line; do echo -n "$line "; done
In order to replace all newlines with spaces using awk, without reading the whole file into memory:
awk '{printf "%s ", $0}' inputfile
If you want a final newline:
awk '{printf "%s ", $0} END {printf "\n"}' inputfile
You can use a character other than space:
awk '{printf "%s|", $0} END {printf "\n"}' inputfile
tr '\n' ' '
is the command.
Simple and easy to use.
Three things.
tr (or cat, etc.) is absolutely not needed. (GNU) sed and (GNU) awk, when combined, can do 99.9% of any text processing you need.
stream != line based. ed is a line-based editor. sed is not. See sed lecture for more information on the difference. Most people confuse sed to be line-based because it is, by default, not very greedy in its pattern matching for SIMPLE matches - for instance, when doing pattern searching and replacing by one or two characters, it by default only replaces on the first match it finds (unless specified otherwise by the global command). There would not even be a global command if it were line-based rather than STREAM-based, because it would evaluate only lines at a time. Try running ed; you'll notice the difference. ed is pretty useful if you want to iterate over specific lines (such as in a for-loop), but most of the times you'll just want sed.
That being said,
sed -e '{:q;N;s/\n/ /g;t q}' file
works just fine in GNU sed version 4.2.1. The above command will replace all newlines with spaces. It's ugly and a bit cumbersome to type in, but it works just fine. The {}'s can be left out, as they're only included for sanity reasons.
Why didn't I find a simple solution with awk?
awk '{printf $0}' file
printf will print the every line without newlines, if you want to separate the original lines with a space or other:
awk '{printf $0 " "}' file
The answer with the :a label ...
How can I replace a newline (\n) using sed?
... does not work in freebsd 7.2 on the command line:
( echo foo ; echo bar ) | sed ':a;N;$!ba;s/\n/ /g'
sed: 1: ":a;N;$!ba;s/\n/ /g": unused label 'a;N;$!ba;s/\n/ /g'
foo
bar
But does if you put the sed script in a file or use -e to "build" the sed script...
> (echo foo; echo bar) | sed -e :a -e N -e '$!ba' -e 's/\n/ /g'
foo bar
or ...
> cat > x.sed << eof
:a
N
$!ba
s/\n/ /g
eof
> (echo foo; echo bar) | sed -f x.sed
foo bar
Maybe the sed in OS X is similar.
Easy-to-understand Solution
I had this problem. The kicker was that I needed the solution to work on BSD's (Mac OS X) and GNU's (Linux and Cygwin) sed and tr:
$ echo 'foo
bar
baz
foo2
bar2
baz2' \
| tr '\n' '\000' \
| sed 's:\x00\x00.*:\n:g' \
| tr '\000' '\n'
Output:
foo
bar
baz
(has trailing newline)
It works on Linux, OS X, and BSD - even without UTF-8 support or with a crappy terminal.
Use tr to swap the newline with another character.
NULL (\000 or \x00) is nice because it doesn't need UTF-8 support and it's not likely to be used.
Use sed to match the NULL
Use tr to swap back extra newlines if you need them
You can use xargs:
seq 10 | xargs
or
seq 10 | xargs echo -n
cat file | xargs
for the sake of completeness
If you are unfortunate enough to have to deal with Windows line endings, you need to remove the \r and the \n:
tr '\r\n' ' ' < $input > $output
I'm not an expert, but I guess in sed you'd first need to append the next line into the pattern space, bij using "N". From the section "Multiline Pattern Space" in "Advanced sed Commands" of the book sed & awk (Dale Dougherty and Arnold Robbins; O'Reilly 1997; page 107 in the preview):
The multiline Next (N) command creates a multiline pattern space by reading a new line of input and appending it to the contents of the pattern space. The original contents of pattern space and the new input line are separated by a newline. The embedded newline character can be matched in patterns by the escape sequence "\n". In a multiline pattern space, the metacharacter "^" matches the very first character of the pattern space, and not the character(s) following any embedded newline(s). Similarly, "$" matches only the final newline in the pattern space, and not any embedded newline(s). After the Next command is executed, control is then passed to subsequent commands in the script.
From man sed:
[2addr]N
Append the next line of input to the pattern space, using an embedded newline character to separate the appended material from the original contents. Note that the current line number changes.
I've used this to search (multiple) badly formatted log files, in which the search string may be found on an "orphaned" next line.
In response to the "tr" solution above, on Windows (probably using the Gnuwin32 version of tr), the proposed solution:
tr '\n' ' ' < input
was not working for me, it'd either error or actually replace the \n w/ '' for some reason.
Using another feature of tr, the "delete" option -d did work though:
tr -d '\n' < input
or '\r\n' instead of '\n'
I used a hybrid approach to get around the newline thing by using tr to replace newlines with tabs, then replacing tabs with whatever I want. In this case, " " since I'm trying to generate HTML breaks.
echo -e "a\nb\nc\n" |tr '\n' '\t' | sed 's/\t/ <br> /g'`
You can also use this method:
sed 'x;G;1!h;s/\n/ /g;$!d'
Explanation
x - which is used to exchange the data from both space (pattern and hold).
G - which is used to append the data from hold space to pattern space.
h - which is used to copy the pattern space to hold space.
1!h - During first line won't copy pattern space to hold space due to \n is
available in pattern space.
$!d - Clear the pattern space every time before getting the next line until the
the last line.
Flow
When the first line get from the input, an exchange is made, so 1 goes to hold space and \n comes to pattern space, appending the hold space to pattern space, and a substitution is performed and deletes the pattern space.
During the second line, an exchange is made, 2 goes to hold space and 1 comes to the pattern space, G append the hold space into the pattern space, h copy the pattern to it, the substitution is made and deleted. This operation is continued until EOF is reached and prints the exact result.
Bullet-proof solution. Binary-data-safe and POSIX-compliant, but slow.
POSIX sed
requires input according to the
POSIX text file
and
POSIX line
definitions, so NULL-bytes and too long lines are not allowed and each line must end with a newline (including the last line). This makes it hard to use sed for processing arbitrary input data.
The following solution avoids sed and instead converts the input bytes to octal codes and then to bytes again, but intercepts octal code 012 (newline) and outputs the replacement string in place of it. As far as I can tell the solution is POSIX-compliant, so it should work on a wide variety of platforms.
od -A n -t o1 -v | tr ' \t' '\n\n' | grep . |
while read x; do [ "0$x" -eq 012 ] && printf '<br>\n' || printf "\\$x"; done
POSIX reference documentation:
sh,
shell command language,
od,
tr,
grep,
read,
[,
printf.
Both read, [, and printf are built-ins in at least bash, but that is probably not guaranteed by POSIX, so on some platforms it could be that each input byte will start one or more new processes, which will slow things down. Even in bash this solution only reaches about 50 kB/s, so it's not suited for large files.
Tested on Ubuntu (bash, dash, and busybox), FreeBSD, and OpenBSD.
In some situations maybe you can change RS to some other string or character. This way, \n is available for sub/gsub:
$ gawk 'BEGIN {RS="dn" } {gsub("\n"," ") ;print $0 }' file
The power of shell scripting is that if you do not know how to do it in one way you can do it in another way. And many times you have more things to take into account than make a complex solution on a simple problem.
Regarding the thing that gawk is slow... and reads the file into memory, I do not know this, but to me gawk seems to work with one line at the time and is very very fast (not that fast as some of the others, but the time to write and test also counts).
I process MB and even GB of data, and the only limit I found is line size.
Finds and replaces using allowing \n
sed -ie -z 's/Marker\n/# Marker Comment\nMarker\n/g' myfile.txt
Marker
Becomes
# Marker Comment
Marker
You could use xargs — it will replace \n with a space by default.
However, it would have problems if your input has any case of an unterminated quote, e.g. if the quote signs on a given line don't match.
On Mac OS X (using FreeBSD sed):
# replace each newline with a space
printf "a\nb\nc\nd\ne\nf" | sed -E -e :a -e '$!N; s/\n/ /g; ta'
printf "a\nb\nc\nd\ne\nf" | sed -E -e :a -e '$!N; s/\n/ /g' -e ta
To remove empty lines:
sed -n "s/^$//;t;p;"
Using Awk:
awk "BEGIN { o=\"\" } { o=o \" \" \$0 } END { print o; }"
A solution I particularly like is to append all the file in the hold space and replace all newlines at the end of file:
$ (echo foo; echo bar) | sed -n 'H;${x;s/\n//g;p;}'
foobar
However, someone said me the hold space can be finite in some sed implementations.
Replace newlines with any string, and replace the last newline too
The pure tr solutions can only replace with a single character, and the pure sed solutions don't replace the last newline of the input. The following solution fixes these problems, and seems to be safe for binary data (even with a UTF-8 locale):
printf '1\n2\n3\n' |
sed 's/%/%p/g;s/#/%a/g' | tr '\n' # | sed 's/#/<br>/g;s/%a/#/g;s/%p/%/g'
Result:
1<br>2<br>3<br>
It is sed that introduces the new-lines after "normal" substitution. First, it trims the new-line char, then it processes according to your instructions, then it introduces a new-line.
Using sed you can replace "the end" of a line (not the new-line char) after being trimmed, with a string of your choice, for each input line; but, sed will output different lines. For example, suppose you wanted to replace the "end of line" with "===" (more general than a replacing with a single space):
PROMPT~$ cat <<EOF |sed 's/$/===/g'
first line
second line
3rd line
EOF
first line===
second line===
3rd line===
PROMPT~$
To replace the new-line char with the string, you can, inefficiently though, use tr , as pointed before, to replace the newline-chars with a "special char" and then use sed to replace that special char with the string you want.
For example:
PROMPT~$ cat <<EOF | tr '\n' $'\x01'|sed -e 's/\x01/===/g'
first line
second line
3rd line
EOF
first line===second line===3rd line===PROMPT~$