My usual 'x' usage was :
print("#" x 78, "\n");
Which concatenates 78 times the string "#". But recently I came across this code:
while (<>) { print if m{^a}x }
Which prints every line of input starting with an 'a'. I understand the regexp matching part (m{^a}), but I really don't see what that 'x' is doing here.
Any explanation would be appreciated.
It's a modifier for the regex. The x modifier tells perl to ignore whitespace and comments inside the regex.
In your example code it does not make a difference because there are no whitespace or comments in the regex.
The "x" in your first case, is a repetition operator, which takes the string as the left argument and the number of times to repeat as the right argument. Perl6 can replicate lists using the "xx" repetition operator.
Your second example uses the regular expression m{^a}x. While you may use many different types of delimiters, neophytes may like to use the familiar notation, which uses a forward slash: m/^a/x
The "x" in a regex is called a modifier or a flag and is but one of many optional flags that may be used. It is used to ignore whitespace in the regex pattern, but it also allows the use of normal comments inside. Because regex patterns can get really long and confusing, using whitespace and comments are very helpful.
Your example is very short (all it says is if the first letter of the line starts with "a"), so you probably wouldn't need whitespace or comments, but you could if you wanted to.
Example:
m/^a # first letter is an 'a'
# <-- you can put more regex on this line because whitespace is ignored
# <-- and more here if you want
/x
In this use case 'x' is a regex modifier which "Extends your pattern's legibility by permitting whitespace and comments." according to the perl documentation. However it seems redundant here
Related
I'm using the vscode vimplugin. I have a bunch of lines that look like:
Terry,169,80,,,47,,,22,,,6,,
I want to remove all the alphanumeric characters after the first comma so I get:
Terry,,,,,,,,,,,,,
In command mode I tried:
s/^.+\,[a-zA-Z0-9-]\+//g
But this does not appear to do anything. How can I get this working?
edit:
s/^[^,]\+,[a-zA-Z0-9-]\+//g
\+ is greedy; ^.\+, eats the entire line up to the last ,.
Instead of the dot (which means "any character") use [^,] which means "any but a comma". Then ^[^,]\+, means "any characters up to the first comma".
The problem with your requirement is that you want to anchor at the beginning using ^ so you cannot use flag g — with the anchor any substitution will be done once. The only way I can solve the puzzle is to use expressions: match and preserve the anchored text and then use function substitute() with flag g.
I managed with the following expression:
:s/\(^[^,]\+\)\(,\+\)\(.\+\)$/\=submatch(1) . submatch(2) . substitute(submatch(3), '[^,]', '', 'g')/
Let me split it in parts. Searching:
\(^[^,]\+\) — first, match any non-commas
\(,\+\) — any number of commas
\(.\+\)$ — all chars to the end of the string
Substituting:
\= — the substitution is an expression
See http://vimdoc.sourceforge.net/htmldoc/change.html#sub-replace-expression
submatch(1) — replace with the first match (non-commas anchored with ^)
submatch(2) — replace with the second match (commas)
substitute(submatch(3), '[^,]', '', 'g') — replace in the rest of the string
The last call to substitute() is simple, it replaces all non-commas with empty strings.
PS. Tested in real vim, not vscode.
I have the following line:
>XXX-220_5004_COVID-A6
TTTATTTGACATGAGTAAATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTCTTTAAA
AGAAGGTCAAATCAATGATATGATTTTATCTCTTCTTAGTAAAGGTAGACTTATAATTAG
AGAAAACAAC
I would like to convert the first line as follows:
>INITWORD/XXX-220_5004_COVID-A6/FINALWORD
TTTATTTGACATGAGTAAATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTCTTTAAA
AGAAGGT...
So far I have managed to add the first word as follows:
sed 's/>/>INITTWORD\//I'
That returns:
>INITWORD/XXX-220_5004_COVID-A6
TTTATTTGACATGAGTAAATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTCTTTAAA
AGAAGGT
How can i add the FINALWORD at the end of the first line?
Just substitute more. sed conveniently allows you to recall the text you matched with a back reference, so just embed that between the things you want to add.
sed 's%^>\(.*\)%>INITWORD/\1/FINALWORD%I' file.fasta
I also added a ^ beginning-of-line anchor, and switched to % delimiters so the slashes don't need to be escaped.
In some more detail, the s command's syntax is s/regex/replacement/flags where regex is a regular expression to match the text you want to replace, and replacement is the text to replace it with. In the regex, you can use grouping parentheses \(...\) to extract some of the matched text into the replacement; so \1 refers to whatever matched the first set of grouping parentheses, \2 to the second, etc. The /flags are optional single-character specifiers which modify the behavior of the command; so for example, a /g flag says to replace every match on a line, instead of just the first one (but we only expect one match per line so it's not necessary or useful here).
The I flag is non-standard but since you are using that, I assume it does something useful for you.
I need help to understand what below command is doing exactly
$abc{hier} =~ s#/tools.*/dfII/?.*##g;
and $abc{hier} contains a path "/home/test1/test2/test3"
Can someone please let me know what the above command is doing exactly. Thanks
s/PATTERN/REPLACEMENT/ is Perl's substitution operator. It searches a string for text that matches the regex PATTERN and replaces it with REPLACEMENT.
By default, the substitution operator works on $_. To tell it to work on a different variable, you use the binding operator - =~.
The default delimiter used by the substitution operator is a slash (/) but you can change that to any other character. This is useful if your PATTERN or your REPLACEMENT contains a slash. In this case, the programmer has used # as the delimiter.
To recap:
$abc{hier} =~ s#PATTERN#REPLACEMENT#;
means "look for text in $abc{hier} that matches PATTERN and replace it with REPLACEMENT.
The substitution operator also has various options that change its behaviour. They are added by putting letters after the final delimiter. In this case we have a g. That means "make the substitution global" - or match and change all occurrences of PATTERN.
In your case, the REPLACEMENT string is empty (we have two # characters next to each other). So we're replacing the PATTERN with nothing - effectively deleting whatever matches PATTERN.
So now we have:
$abc{hier} =~ s#PATTERN*##g;
And we know it means, "in the variable $abc{hier}, look for any string that matches PATTERN and replace it with nothing".
The last thing to look at is the PATTERN (or regular expression - "regex"). You can get the full definition of regexes in perldoc perlre. But to explain what we're using here:
/tools : is the fixed string "/tools"
.* : is zero or more of any character
/dfII : is the fixed string "/dfII"
/? : is an optional slash character
.* : is (again) zero or more of any character
So, basically, we're removing bits of a file path from a value that's stored in a hash.
This =~ means "Do a regex operation on that variable."
(Actually, as ikegami correctly reminds me, it is not necessarily only regex operations, because it could also be a transliteration.)
The operation in question is s#something#else#, which means replace the "something" with something "else".
The g at the end means "Do it for all occurences of something."
Since the "else" is empty, the replacement has the effect of deleting.
The "something" is a definition according to regex syntax, roughly it means "Starting with '/tools' and later containing '/dfII', followed pretty much by anything until the end."
Note, the regex mentions at the end /?.*. In detail, this would mean "A slash (/) , or maybe not (?), and then absolutely anything (.) any number of times including 0 times (*). Strictly speaking it is not necessary to define "slash or not", if it is followed by "anything any often", because "anything" includes as slash, and anyoften would include 0 or one time; whether it is followed by more "anything" or not. I.e. the /? could be omitted, without changing the behaviour.
(Thanks ikeagami for confirming.)
$abc{hier} =~ s#/tools.*/dfII/?.*##g;
The above commands use regular expression to strip/remove trailing /tools.*/dfII and
/tools.*/dfII/.* from value of hier member of %abc hash.
It is pretty basic perl except non standard regular expression limiters (# instead of standard /). It allows to avoid escaping / inside the regular expression (s/\/tools.*\/dfII\/?.*//g).
My personal preferred style-guide would make it s{/tools.*/dfII/?.*}{}g .
I've to match a regular-expression, stored in a variable:
#!/bin/env perl
use warnings;
use strict;
my $expr = qr/\s*(\w+(\[\d+\])?)\s+(\w+(\[\d+\])?)/sx;
$str = "abcd[3] xyzg[4:0]";
if ($str =~ m/$expr/) {
print "\n%%%%%%%%% $`-----$&-----$'\n";
}
else {
print "\n********* NOT MATCHED\n";
}
But I'm getting the outout in $& as
%%%%%%%%% -----abcd[3] xyzg-----[4:0]
But expecting, it shouldn't go inside the if clause.
What is intended is:
if $str = "abcd xyzg" => %%%%%%%%% -----abcd xyzg----- (CORRECT)
if $str = "abcd[2] xyzg" => %%%%%%%%% -----abcd[2] xyzg----- (CORRECT)
if $str = "abcd[2] xyzg[3] => %%%%%%%%% -----abcd[2] xyzg[3]----- (CORRECT)
if $str = "abcd[2:0] xyzg[3] => ********* NOT MATCHED (CORRECT)
if $str = "abcd[2:0] xyzg[3:0] => ********* NOT MATCHED (CORRECT)
if $str = "abcd[2] xyzg[3:0]" => ********* NOT MATCHED (CORRECT/INTENDED)
but output is %%%%%%%%% -----abcd[2] xyzg-----[3:0] (WRONG)
OR better to say this is not intended.
In this case, it should/my_expectation go to the else block.
Even I don't know, why $& take a portion of the string (abcd[2] xyzg), and $' having [3:0]?
HOW?
It should match the full, not a part like the above. If it didn't, it shouldn't go to the if clause.
Can anyone please help me to change my $expr pattern, so that I can have what is intended?
By default, Perl regexes only look for a matching substring of the given string. In order to force comparison against the entire string, you need to indicate that the regex begins at the beginning of the string and ends at the end by using ^ and $:
my $expr = qr/^\s*(\w+(\[\d+\])?)\s+(\w+(\[\d+\])?)$/;
(Also, there's no reason to have the /x modifier, as your regex doesn't include any literal whitespace or # characters, and there's no reason for the /s modifier, as you're not using ..)
EDIT: If you don't want the regex to match against the entire string, but you want it to reject anything in which the matching portion is followed by something like "[0:0]", the simplest way would be to use lookahead:
my $expr = qr/^\s*(\w+(\[\d+\])?)\s+(\w+(\[\d+\]|(?=[^[\w])|$ ))/x;
This will match anything that takes the following form:
beginning of the string (which your example in the comments seems to imply you want)
zero or more whitespace characters
one or more word characters
optional: [, one or more digits, ]
one or more whitespace characters
one or more word characters
one of the following, in descending order of preference:
[, one or more digits, ]
an empty string followed by (but not including!) a character that is neither [ nor a word character (The exclusion of word characters is to keep the regex engine from succeeding on "a[0] bc[1:2]" by only matching "a[0] b".)
end of string (A space is needed after the $ to keep it from merging with the following ) to form the name of a special variable, and this entails the reintroduction of the /x option.)
Do you have any more unstated requirements that need to be satisfied?
The short answer is your regexp is wrong.
We can't fix it for you without you explaining what you need exactly, and the community is not going to write a regexp exactly for your purpose because that's just too localized a question that only helps you this one time.
You need to ask something more general about regexps that we can explain to you, that will help you fix your regexp, and help others fix theirs.
Here's my general answer when you're having trouble testing your regexp. Use a regexp tool, like the regex buddy one.
So I'm going to give a specific answer about what you're overlooking here:
Let's make this example smaller:
Your pattern is a(bc+d)?. It will match: abcd abccd etc. While it will not match bcd nor bzd in the case of abzd it will match as matching only a because the whole group of bc+d is optional. Similarly it will match abcbcd as a dropping the whole optional group that couldn't be matched (at the second b).
Regexps will match as much of the string as they can and return a true match when they can match something and have satisfied the entire pattern. If you make something optional, they will leave it out when they have to including it only when it's present and matches.
Here's what you tried:
qr/\s*(\w+(\[\d+\])?)\s+(\w+(\[\d+\])?)/sx
First, s and x aren't needed modifiers here.
Second, this regex can match:
Any or no whitespace followed by
a word of at least one alpha character followed by
optionally a grouped square bracketed number with at least one digit (eg [0] or [9999]) followed by
at least one white space followed by
a word of at least one alpha character followed by
optionally a square bracketed number with at least one digit.
Clearly when you ask it to match abcd[0] xyzg[0:4] the colon ends the \d+ pattern but doesn't satisfy the \] so it backtracks the whole group, and then happily finds the group was optional. So by not matching the last optional group, your pattern has matched successfully.
When I try to build a package with the following in my .Rbuildignore file,
*pdf
*Rdata
I get the errors:
Warning in readLines(ignore_file) :
incomplete final line found on '/home/user/project/.Rbuildignore'
and
invalid regular expression '*pdf'
I thought '*' was a wildcard for one or more characters?
There are two styles of pattern matching for files:
regular expressions. These are used for general string pattern matching. See ?regex
globs. These are typically used by UNIX shells. See ?Sys.glob
You seem to be thinking in terms of globs but .Rbuildignore uses regular expressions. To convert a glob to a regular expression try
> glob2rx("*pdf")
[1] "^.*pdf$"
See help(regex) for help on regular expression, esp. the Perl variant, and try
.*pdf
.*Rdata
instead. The 'dot' matches any chartacter, and the 'star' says that it can repeat zero or more times. I just tried it on a package of mine and this did successfully ignore a pdf vignette as we asked it to.
In a perl regexp, use .*? as a wildcard.
But I think that what you actually want is pdf$ and Rdata$ as entries in .Rbuildignore seem to affect files whose paths they match only partially, too. $ means "end of the path".
* is a quantifier that attaches to a previous expression to allow between 0 and infinite repetitions of it. Since you have not preceded the quantifier with an expression, this is an error.
. is an expression that matches any character. So I suspect that you want .*pdf, .*Rdata, etc.