I am writing a program where if no command line arguments are supplied i.e #ARGV == 0, the program takes in three inputs. But, the program has the feature to read any files given as arguments, thus
calculate input1 input2
runs the formula on the numbers found in file1 and file2.
The problem I am running into is when I run
calculate < input1
#ARGV returns 0, thus it runs the code for user input.
How do I get around this so that the program can read input1 and use the values inside for calculations?
calculate < input1 is equivalent to cat input1 | calculate.
You need to read from <STDIN> and not look for command line arguments.
That should not be a problem. If you read reading from <> (which is really <ARGV>), then there is no difference.
You must be doing something wrong if redirection changes things. Are you actually opening files yourself???
You might consider using a module like Getopt::Euclid or Getopt::Long to make the argument passing more explicit. That might make the program easier to understand for other users too.
Related
-- Edit : Resolved. See answer.
Background:
I'm writing a shell that will perform some extra actions required on our system when someone resizes a database.
The shell is written in ksh (requirement), the OS is Solaris 5.10 .
The problem is with one of the checks, which verifies there's enough free space on the underlying OS.
Problem:
The check reads the df -k line for root, which is what I check in this step, and prints it to a file. I then "read" the contents into variables which I use in calculations.
Unfortunately, when I try to run an arithmetic operation on one of the variables, I get an error indicating it is null. And a debug output line I've placed after that line verifies that it is null... It lost it's value...
I've tried every method of doing this I could find online, they work when I run it manually, but not inside the shell file.
(* The file does have #!/usr/bin/ksh)
Code:
df -k | grep "rpool/ROOT" > dftest.out
RPOOL_NAME=""; declare -i TOTAL_SIZE=0; USED_SPACE=0; AVAILABLE_SPACE=0; AVAILABLE_PERCENT=0; RSIGN=""
read RPOOL_NAME TOTAL_SIZE USED_SPACE AVAILABLE_SPACE AVAILABLE_PERCENT RSIGN < dftest.out
\rm dftest.out
echo $RPOOL_NAME $TOTAL_SIZE $USED_SPACE $AVAILABLE_SPACE $AVAILABLE_PERCENT $RSIGN
((TOTAL_SIZE=$TOTAL_SIZE/1024))
This is the result:
DBResize.sh[11]: TOTAL_SIZE=/1024: syntax error
I'm pulling hairs at this point, any help would be appreciated.
The code you posted cannot produce the output you posted. Most obviously, the error is signalled at line 11 but you posted fewer than 11 lines of code. The previous lines may matter. Always post complete code when you ask for help.
More concretely, the declare command doesn't exist in ksh, it's a bash thing. You can achieve the same result with typeset (declare is a bash equivalent to typeset, but not all options are the same). Either you're executing this script with bash, or there's another error message about declare, or you've defined some additional commands including declare which may change the behavior of this code.
None of this should have an impact on the particular problem that you're posting about, however. The variables created by read remain assigned until the end of the subshell, i.e. until the code hits a ), the end of a pipe (left-hand side of the pipe only in ksh), etc.
About the use of declare or typeset, note that you're only declaring TOTAL_SIZE as an integer. For the other variables, you're just assigning a value which happens to consist exclusively of digits. It doesn't matter for the code you posted, but it's probably not what you meant.
One thing that may be happening is that grep matches nothing, and therefore read reads an empty line. You should check for errors. Use set -e in scripts to exit at the first error. (There are cases where set -e doesn't catch errors, but it's a good start.)
Another thing that may be happening is that df is splitting its output onto multiple lines because the first column containing the filesystem name is too large. To prevent this splitting, pass the option -P.
Using a temporary file is fragile: the code may be executed in a read-only directory, another process may want to access the same file at the same time... Here a temporary file is useless. Just pipe directly into read. In ksh (unlike most other sh variants including bash), the right-hand side of a pipe runs in the main shell, so assignments to variables in the right-hand side of a pipe remain available in the following commands.
It doesn't matter in this particular script, but you can use a variable without $ in an arithmetic expression. Using $ substitutes a string which can have confusing results, e.g. a='1+2'; $((a*3)) expands to 7. Not using $ uses the numerical value (in ksh, a='1+2'; $((a*3)) expands to 9; in some sh implementations you get an error because a's value is not numeric).
#!/usr/bin/ksh
set -e
typeset -i TOTAL_SIZE=0 USED_SPACE=0 AVAILABLE_SPACE=0 AVAILABLE_PERCENT=0
df -Pk | grep "rpool/ROOT" | read RPOOL_NAME TOTAL_SIZE USED_SPACE AVAILABLE_SPACE AVAILABLE_PERCENT RSIGN
echo $RPOOL_NAME $TOTAL_SIZE $USED_SPACE $AVAILABLE_SPACE $AVAILABLE_PERCENT $RSIGN
((TOTAL_SIZE=TOTAL_SIZE/1024))
Strange...when I get rid of your "declare" line, your original code seems to work perfectly well (at least with ksh on Linux)
The code :
#!/bin/ksh
df -k | grep "/home" > dftest.out
read RPOOL_NAME TOTAL_SIZE USED_SPACE AVAILABLE_SPACE AVAILABLE_PERCENT RSIGN < dftest.out
\rm dftest.out
echo $RPOOL_NAME $TOTAL_SIZE $USED_SPACE $AVAILABLE_SPACE $AVAILABLE_PERCENT $RSIGN
((TOTAL_SIZE=$TOTAL_SIZE/1024))
print $TOTAL_SIZE
The result :
32962416 5732492 25552588 19% /home
5598
Which are the value a simple df -k is returning. The variables seem to last.
For those interested, I have figured out that it is not possible to use "read" the way I was using it.
The variable values assigned by "read" simply "do not last".
To remedy this, I have applied the less than ideal solution of using the standard "while read" format, and inside the loop, echo selected variables into a variable file.
Once said file was created, I just "loaded" it.
(pseudo code:)
LOOP START
echo "VAR_A="$VAR_A"; VAR_B="$VAR_B";" > somefile.out
LOOP END
. somefile.out
I am currently working on a project but I have one big problem. I have some picture with a whitespace in the name and I want to do a montage. The problem is that I can't rename my picture and my code is like that :
$pic1 = qq(picture one.png);
$pic2 = qq(picture two.png);
my $cmd = "C:\...\montage.exe $pic1 $pic2 output.png";
system($cmd);
but because of the whitespace montage.exe doesn't work. How can I execute my code without renaming all my pictures?
Thanks a lot for your answer!
You can properly quote the filenames within the string you pass to system, as #Borodin shows in his answer. Something like: system("montage.exe '$pic1' '$pic2'")
However, A more reliable and safer solution is to pass the arguments to montage.exe as extra parameters in the system call:
system('montage.exe', $pic2, $pic2, 'output.png')
Now you don't have to worry about nesting the correct quotes, or worry about files with unexpected characters. Not only is this simpler code, but it avoids malicious injection issues, should those file names ever come from a tainted source. Someone could enter | rm *, but your system call will not remove all your files for you.
Further, in real life, you probably are not going to have a separate scalar variable for each file name. You'll have them in an array. This makes your system call even easier:
system('montage.exe', #filenames, 'output.png')
Not only is that super easy, but it avoids the pitfall of having a command line too long. If your filenames have nice long paths (maybe 50-100 characters), a Windows command line will exceed the max command length after around 100 files. Passing the arguments through system() instead of in one big string avoids that limitation.
Alternatively, you can pass the arguments to montage.exe as a list (instead of concatenating them all into a string):
use strict;
use warnings;
my $pic1 = qq(picture one.png);
my $pic2 = qq(picture two.png);
my #cmd = ("C:\...\montage.exe", $pic1, $pic2, "output.png");
system(#cmd);
You need to put quotes around the file names that have spaces. You also need to escape the backslashes
my $cmd = qq{C:\\...\\montage.exe "$pic1" "$pic2" output.png};
In unix systems, the best approach is the multi-argument form of system because 1) it avoids invoking a shell, and 2) that's the format accepted by the OS call. Neither of those are true in Windows. The OS call to spawn a program expects a command line, and system's attempt to form this command line is sometimes incorrect. The safest approach is to use Win32::ShellQuote.
use Win32::ShellQuote qw( quote_system );
system quote_system("C:\\...\\montage.exe", $pic1, $pic2, "output.png");
I have an existing perl one-liner (from the Edwards lab) that works wonderfully to read a text file (named ids.file) that contains one column of IDs and searches a second, specially formatted text file (named fasta.file in this example - in "fasta" format for those who know bioinformatics) and returns sequences that match the ID from the first file. I was hoping to expand this script to do two additional things:
The current perl one-liner only seems to work if the ids.file contains one column of data. I would like it to work on a file that contains two columns (separated by spaces), and act on the second column of data (well, really any column of data, but I assume that it will be obvious enough to adapt it if someone can give an example using a second column)
I would like to append the any results returned from the output of the search to a third column, instead of just to a new file.
If someone is kind enough to offer an example but only has time or inclination to work on one of these, I would prefer that you try to solve #2 - I have come close to solving #1 with a for loop that uses awk to only use the Perl code on the second column - I haven't gotten it yet, but am close, so #2 seems like the harder one to me.
The perl one liner is as follows:
perl -ne 'if(/^>(\S+)/){$c=$i{$1}}$c?print:chomp;$i{$_}=1 if #ARGV' ids.file fasta.file
I appreciate any help you can give!
Not quite sure but will this do?
perl -ne 'chomp; s/^>(\S+).*/$c=$i{$1}/e; print if $c;
$i{(/^\S*\s(\S*)$/)[0]}="$_ " if #ARGV'
ids.file fasta.file
so I call an external program in perl and want to capture it's output:
my #RNAalifoldOut = `RNAalifold some parameters`;
If called from command line the output consists of three lines, e.g:
4 sequences; length of alignment 48.
__GCCGA_UGUAGCUCAGUUGGG_AGAGCGCCAGACUGAAAAUCAGA
...((((.....((((.........)))).(((((.......)))))
However my array #RNAalifoldOut contains only the two last lines and the first line appears directly on the screen when the line is being executed.
How can this be? I thought maybe the program writes the first line to STDERR, but isn't that discarded by the backticks operator? And what could I do to hide this output?
Regards
Nick
You are likely seeing the standard error from RNAalifold. Backticks capture only the standard output.
Capture both standard output and standard error by changing your code to
my #RNAalifoldOut = `RNAalifold some parameters 2>&1`;
To discard the standard error, use
my #RNAalifoldOut = `RNAalifold some parameters 2>/dev/null`;
on Unix-like platforms. On Windows, use
my #RNAalifoldOut = `RNAalifold some parameters 2>nul`;
So me being the 'noob' that I am, being introduced to programming via Perl just recently, I'm still getting used to all of this. I have a .fasta file which I have to use, although I'm unsure if I'm able to open it, or if I have to work with it 'blindly', so to speak.
Anyway, the file that I have contains DNA sequences for three genes, written in this .fasta format.
Apparently it's something like this:
>label
sequence
>label
sequence
>label
sequence
My goal is to write a script to open and read the file, which I have gotten the hang of now, but I have to read each sequence, compute relative amounts of 'G' and 'C' within each sequence, and then I'm to write it to a TAB-delimited file the names of the genes, and their respective 'G' and 'C' content.
Would anyone be able to provide some guidance? I'm unsure what a TAB-delimited file is, and I'm still trying to figure out how to open a .fasta file to actually see the content. So far I've worked with .txt files which I can easily open, but not .fasta.
I apologise for sounding completely bewildered. I'd appreciate your patience. I'm not like you pros out there!!
I get that it's confusing, but you really should try to limit your question to one concrete problem, see https://stackoverflow.com/faq#questions
I have no idea what a ".fasta" file or 'G' and 'C' is.. but it probably doesn't matter.
Generally:
Open input file
Read and parse data. If it's in some strange format that you can't parse, go hunting on http://metacpan.org for a module to read it. If you're lucky someone has already done the hard part for you.
Compute whatever you're trying to compute
Print to screen (standard out) or another file.
A "TAB-delimite" file is a file with columns (think Excel) where each column is separated by the tab ("\t") character. As quick google or stackoverflow search would tell you..
Here is an approach using 'awk' utility which can be used from the command line. The following program is executed by specifying its path and using awk -f <path> <sequence file>
#NR>1 means only look at lines above 1 because you said the sequence starts on line 2
NR>1{
#this for-loop goes through all bases in the line and then performs operations below:
for (i=1;i<=length;i++)
#for each position encountered, the variable "total" is increased by 1 for total bases
total++
}
{
for (i=1;i<=length;i++)
#if the "substring" i.e. position in a line == c or g upper or lower (some bases are
#lowercase in some fasta files), it will carry out the following instructions:
if(substr($0,i,1)=="c" || substr($0,i,1)=="C")
#this increments the c count by one for every c or C encountered, the next if statement does
#the same thing for g and G:
c++; else
if(substr($0,i,1)=="g" || substr($0,i,1)=="G")
g++
}
END{
#this "END-block" prints the gene name and C, G content in percentage, separated by tabs
print "Gene name\tG content:\t"(100*g/total)"%\tC content:\t"(100*c/total)"%"
}