Here is the script of user Suic for calculating molecular weight of fasta sequences (calculating molecular weight in perl),
#!/usr/bin/perl
use strict;
use warnings;
use Encode;
for my $file (#ARGV) {
open my $fh, '<:encoding(UTF-8)', $file;
my $input = join q{}, <$fh>;
close $fh;
while ( $input =~ /^(>.*?)$([^>]*)/smxg ) {
my $name = $1;
my $seq = $2;
$seq =~ s/\n//smxg;
my $mass = calc_mass($seq);
print "$name has mass $mass\n";
}
}
sub calc_mass {
my $a = shift;
my #a = ();
my $x = length $a;
#a = split q{}, $a;
my $b = 0;
my %data = (
A=>71.09, R=>16.19, D=>114.11, N=>115.09,
C=>103.15, E=>129.12, Q=>128.14, G=>57.05,
H=>137.14, I=>113.16, L=>113.16, K=>128.17,
M=>131.19, F=>147.18, P=>97.12, S=>87.08,
T=>101.11, W=>186.12, Y=>163.18, V=>99.14
);
for my $i( #a ) {
$b += $data{$i};
}
my $c = $b - (18 * ($x - 1));
return $c;
}
and the protein.fasta file with n (here is 2) sequences:
seq_ID_1 descriptions etc
ASDGDSAHSAHASDFRHGSDHSDGEWTSHSDHDSHFSDGSGASGADGHHAH
ASDSADGDASHDASHSAREWAWGDASHASGASGASGSDGASDGDSAHSHAS
SFASGDASGDSSDFDSFSDFSD
>seq_ID_2 descriptions etc
ASDGDSAHSAHASDFRHGSDHSDGEWTSHSDHDSHFSDGSGASGADGHHAH
ASDSADGDASHDASHSAREWAWGDASHASGASGASG
When using: perl molecular_weight.pl protein.fasta > output.txt
in terminal, it will generate the correct results, however it also presents an error of "Use of unitialized value in addition (+) at molecular_weight.pl line36", which is just localized in line of "$b += $data{$i};" how to fix this bug ? Thanks in advance !
You probably have an errant SPACE somewhere in your data file. Just change
$seq =~ s/\n//smxg;
into
$seq =~ s/\s//smxg;
EDIT:
Besides whitespace, there may be some non-whitespace invisible characters in the data, like WORD JOINER (U+2060).
If you want to be sure to be thorough and you know all the legal symbols, you can delete everything apart from them:
$seq =~ s/[^ARDNCEQGHILKMFPSTWYV]//smxg;
Or, to make sure you won't miss any (even if you later change the symbols), you can populate a filter regex dynamically from the hash keys.
You'd need to make %Data and the filter regex global, so the filter is available in the main loop. As a beneficial side effect, you don't need to re-initialize the data hash every time you enter calc_mass().
use strict;
use warnings;
my %Data = (A=>71.09,...);
my $Filter_regex = eval { my $x = '[^' . join('', keys %Data) . ']'; qr/$x/; };
...
$seq =~ s/$Filter_regex//smxg;
(This filter works as long as the symbols are single character. For more complicated ones, it may be preferable to match for the symbols and collect them from the sequence, instead of removing unwanted characters.)
I have a below fix file and I want to find out how many orders are sent at same time. I am using tag 52 as the sending time.
Below is the file,
8=FIX.4.2|9=115|35=A|52=20080624-12:43:38.021|10=186|
8=FIX.4.2|52=20080624-12:43:38.066|10=111|
8=FIX.4.2|9=105|35=1|22=BOO|52=20080624-12:43:39.066|10=028|
If I want to count number how many same occurances of Tag 52 values were sent? How can I check?
So far, I have written below code but not giving me the frequency.
#!/usr/bin/perl
$f = '2.txt';
open (F,"<$f") or die "Can not open\n";
while (<F>)
{
chomp $_;
#data = split (/\|/,$_);
foreach $data (#data)
{
if ( $data == 52){
#data1 = split ( /=/,$data);
for my $j (#data1)
{
$hash{$j}++;
} for my $j (keys %hash)
{
print "$j: ", $hash{j}, "\n";
}
}
}
}
Here is your code corrected:
#!/usr/bin/perl
$f = '2.txt';
open (F,"<$f") or die "Can not open\n";
my %hash;
while (<F>) {
chomp $_;
#data = split (/\|/,$_);
foreach $data (#data) {
if ($data ~= /^52=(.*)/) {
$hash{$1}++;
}
}
}
for my $j (keys %hash) {
print "$j: ", $hash{j}, "\n";
}
Explanation:
if ( $data == 52) compares the whole field against value 52, not a substring of the field. Of course, you do not have such fields, and the test always fails. I replaces it with a regexp comparison.
The same regexp gives an opportunity to catch a timestamp immediately, without a need to split the field once more. It is done by (.*) in the regexp and $1 in the following assignment.
It is hardly makes sense to output the hash for every line of input data (your code outputs it within the foreach loop). I moved it down. But maybe, outputting the current hash for every line is what you wanted, I do not know.
FILE:
1,2015-08-20,00:00:00,89,1007.48,295.551,296.66,
2,2015-08-20,03:00:00,85,1006.49,295.947,296.99,
3,2015-08-20,06:00:00,86,1006.05,295.05,296.02,
4,2015-08-20,09:00:00,85,1005.87,296.026,296.93,
5,2015-08-20,12:00:00,77,1004.96,298.034,298.87
code:
use IPC::System::Simple qw( capture capturex );
use POSIX;
my $tb1_file = '/var/egridmanage_pl/daily_pl/egrid-csv/test.csv';
open my $fh1, '<', $tb1_file or die qq{Unable to open "$tb1_file" for input: $!};
my #t1_temp_12 = map {
chomp;
my #t1_ft_12 = split /,/;
sprintf "%.0f", $t1_ft_12[6] if $t1_ft_12[2] eq '12:00:00';
} <$fh1>;
print "TEMP #t1_temp_12\n";
my $result = #t1_temp_12 - 273.14;
print "$result should equal something closer to 24 ";
$result value prints out -265.14 making me think the #t1_temp_12 is hashed
So I tried to do awk
my $12temp = capture("awk -F"," '$3 == "12:00:00" {print $7 - 273-.15}' test.csv");
I've tried using ``, qx, open, system all having the same error result using the awk command
But this errors out. When executing awk at command line i get the favoured results.
This looks like there's some cargo cult programming going on here. It looks like all you're trying to do is find the line for 12:00:00 and print the temperature in degrees C rather than K.
Which can be done like this:
#!/usr/bin/perl
use strict;
use warnings;
while (<DATA>) {
my #fields = split /,/;
print $fields[6] - 273.15 if $fields[2] eq "12:00:00";
}
__DATA__
1,2015-08-20,00:00:00,89,1007.48,295.551,296.66,
2,2015-08-20,03:00:00,85,1006.49,295.947,296.99,
3,2015-08-20,06:00:00,86,1006.05,295.05,296.02,
4,2015-08-20,09:00:00,85,1005.87,296.026,296.93,
5,2015-08-20,12:00:00,77,1004.96,298.034,298.87
Prints:
25.72
You don't really need to do map sprintf etc. (Although you could do a printf on that output if you do want to format it).
Edit: From the comments, it seems one of the sources of confusion is extracting an element from an array. An array is zero or more scalar elements - you can't just assign one to the other, because .... well, what should happen if there isn't just one element (which is the usual case).
Given an array, we can:
pop #array will return the last element (and remove it from the array) so you could my $result = pop #array;
[0] is the first element of the array, so we can my $result = $array[0];
Or we can assign one array to another: my ( $result ) = #array; - because on the left hand side we have an array now, and it's a single element - the first element of #array goes into $result. (The rest isn't used in this scenario - but you could do my ( $result, #anything_else ) = #array;
So in your example - if what you're trying to do is retrieve a value matching a criteria - the normal tool for the job would be grep - which filters an array by applying a conditional test to each element.
So:
my #lines = grep { (split /,/)[2] eq "12:00:00" } <DATA>;
print "#lines";
print $lines[0];
Which we can reduce to:
my ( $firstresult ) = grep { (split /,/)[2] eq "12:00:00" } <DATA>;
print $firstresult;
But as we want to want to transform our array - map is the tool for the job.
my ( $result ) = map { (split /,/)[6] - 273.15 } grep { (split /,/)[2] eq "12:00:00" } <DATA>;
print $result;
First we:
use grep to extract the matching elements. (one in this case, but doesn't necessarily have to be!)
use map to transform the list, so that that we turn each element into just it's 6th field, and subtract 273.15
assign the whole lot to a list containing a single element - in effect just taking the first result, and throwing the rest away.
But personally, I think that's getting a bit complicated and may be hard to understand - and would suggest instead:
my $result;
while (<DATA>) {
my #fields = split /,/;
if ( $fields[2] eq "12:00:00" ) {
$result = $fields[6] - 273.15;
last;
}
}
print $result;
Iterate your data, split - and test - each line, and when you find one that matches the criteria - set $result and bail out of the loop.
#t1_temp_12 is an array. Why are you trying to subtract an single value from it?
my $result = "#t1_temp_12 - 273.14";
Did you want to do this instead?
#t1_temp_12 = map {$_ - 273.14} #t1_temp_12;
As a shell one-liner, you could write your entire script as:
perl -F, -lanE 'say $F[6]-273.14 if $F[2] eq "12:00:00"' <<DATA
1,2015-08-20,00:00:00,89,1007.48,295.551,296.66,
2,2015-08-20,03:00:00,85,1006.49,295.947,296.99,
3,2015-08-20,06:00:00,86,1006.05,295.05,296.02,
4,2015-08-20,09:00:00,85,1005.87,296.026,296.93,
5,2015-08-20,12:00:00,77,1004.96,298.034,298.87
DATA
25.73
So i have been working on this perl script that will analyze and count the same letters in different line spaces. I have implemented the count to a hash but am having trouble excluding a " - " character from the output results of this hash. I tried using delete command or next if, but am not getting rid of the - count in the output.
So with this input:
#extract = ------------------------------------------------------------------MGG-------------------------------------------------------------------------------------
And following code:
#Count selected amino acids.
my %counter = ();
foreach my $extract(#extract) {
#next if $_ =~ /\-/; #This line code does not function correctly.
$counter{$_}++;
}
sub largest_value_mem (\%) {
my $counter = shift;
my ($key, #keys) = keys %$counter;
my ($big, #vals) = values %$counter;
for (0 .. $#keys) {
if ($vals[$_] > $big) {
$big = $vals[$_];
$key = $keys[$_];
}
}
$key
}
I expect the most common element to be G, same as the output. If there is a tie in the elements, say G = M, if there is a way to display both in that would be great but not necessary. Any tips on how to delete or remove the '-' is much appreciated. I am slowly learning perl language.
Please let me know if what I am asking is not clear or if more information is needed, thanks again kindly for all the comments.
Your data doesn't entirely make sense, since it's not actually working perl code. I'm guessing that it's a string divided into characters. After that it sounds like you just want to be able to find the highest frequency character, which is essentially just a sort by descending count.
Therefore the following demonstrates how to count your characters and then sort the results:
use strict;
use warnings;
my $str = '------------------------------------------------------------------MGG-------------------------------------------------------------------------------------';
my #chars = split '', $str;
#Count Characteres
my %count;
$count{$_}++ for #chars;
delete $count{'-'}; # Don't count -
# Sort keys by count descending
my #keys = sort {$count{$b} <=> $count{$a}} keys %count;
for my $key (#keys) {
print "$key $count{$key}\n";
}
Outputs:
G 2
M 1
foreach my $extract(#extract) {
#next if $_ =~ /\-/
$_ setting is suppressed by $extract here.
(In this case, $_ keeps value from above, e.g. routine argument list, previous match, etc.)
Also, you can use character class for better readability:
next if $extract=~/[-]/;
Another question for everyone. To reiterate I am very new to the Perl process and I apologize in advance for making silly mistakes
I am trying to calculate the GC content of different lengths of DNA sequence. The file is in this format:
>gene 1
DNA sequence of specific gene
>gene 2
DNA sequence of specific gene
...etc...
This is a small piece of the file
>env
ATGCTTCTCATCTCAAACCCGCGCCACCTGGGGCACCCGATGAGTCCTGGGAA
I have established the counter and to read each line of DNA sequence but at the moment it is do a running summation of the total across all lines. I want it to read each sequence, print the content after the sequence read then move onto the next one. Having individual base counts for each line.
This is what I have so far.
#!/usr/bin/perl
#necessary code to open and read a new file and create a new one.
use strict;
my $infile = "Lab1_seq.fasta";
open INFILE, $infile or die "$infile: $!";
my $outfile = "Lab1_seq_output.txt";
open OUTFILE, ">$outfile" or die "Cannot open $outfile: $!";
#establishing the intial counts for each base
my $G = 0;
my $C = 0;
my $A = 0;
my $T = 0;
#initial loop created to read through each line
while ( my $line = <INFILE> ) {
chomp $line;
# reads file until the ">" character is encounterd and prints the line
if ($line =~ /^>/){
print OUTFILE "Gene: $line\n";
}
# otherwise count the content of the next line.
# my percent counts seem to be incorrect due to my Total length counts skewing the following line. I am currently unsure how to fix that
elsif ($line =~ /^[A-Z]/){
my #array = split //, $line;
my $array= (#array);
# reset the counts of each variable
$G = ();
$C = ();
$A = ();
$T = ();
foreach $array (#array){
#if statements asses which base is present and makes a running total of the bases.
if ($array eq 'G'){
++$G;
}
elsif ( $array eq 'C' ) {
++$C; }
elsif ( $array eq 'A' ) {
++$A; }
elsif ( $array eq 'T' ) {
++$T; }
}
# all is printed to the outfile
print OUTFILE "G:$G\n";
print OUTFILE "C:$C\n";
print OUTFILE "A:$A\n";
print OUTFILE "T:$T\n";
print OUTFILE "Total length:_", ($A+=$C+=$G+=$T), "_base pairs\n";
print OUTFILE "GC content is(percent):_", (($G+=$C)/($A+=$C+=$G+=$T)*100),"_%\n";
}
}
#close the outfile and the infile
close OUTFILE;
close INFILE;
Again I feel like I am on the right path, I am just missing some basic foundations. Any help would be greatly appreciated.
The final problem is in the final counts printed out. My percent values are wrong and give me the wrong value. I feel like the total is being calculated then that new value is incorporated into the total.
Several things:
1. use hash instead of declaring each element.
2. assignment such as $G = (0); is indeed working, but it is not the right way to assign scalar. What you did is declaring an array, which in scalar context $G = is returning the first array item. The correct way is $G = 0.
my %seen;
$seen{/^([A-Z])/}++ for (grep {/^\>/} <INFILE>);
foreach $gene (keys %seen) {
print "$gene: $seen{$gene}\n";
}
Just reset the counters when a new gene is found. Also, I'd use hashes for the counting:
use strict; use warnings;
my %counts;
while (<>) {
if (/^>/) {
# print counts for the prev gene if there are counts:
print_counts(\%counts) if keys %counts;
%counts = (); # reset the counts
print $_; # print the Fasta header
} else {
chomp;
$counts{$_}++ for split //;
}
}
print_counts(\%counts) if keys %counts; # print counts for last gene
sub print_counts {
my ($counts) = #_;
print "$_:=", ($counts->{$_} || 0), "\n" for qw/A C G T/;
}
Usage: $ perl count-bases.pl input.fasta.
Example output:
> gene 1
A:=3
C:=1
G:=5
T:=5
> gene 2
A:=1
C:=5
G:=0
T:=13
Style comments:
When opening a file, always use lexical filehandles (normal variables). Also, you should do a three-arg open. I'd also recommend the autodie pragma for automatic error handling (since perl v5.10.1).
use autodie;
open my $in, "<", $infile;
open my $out, ">", $outfile;
Note that I don't open files in my above script because I use the special ARGV filehandle for input, and print to STDOUT. The output can be redirected on the shell, like
$ perl count-bases.pl input.fasta >counts.txt
Declaring scalar variables with their values in parens like my $G = (0) is weird, but works fine. I think this is more confusing than helpful. → my $G = 0.
Your intendation is a bit weird. It is very unusual and visually confusing to put closing braces on the same line with another statement like
...
elsif ( $array eq 'C' ) {
++$C; }
I prefer cuddling elsif:
...
} elsif ($base eq 'C') {
$C++;
}
This statement my $array= (#array); puts the length of the array into $array. What for? Tip: You can declare variables right inside foreach-loops, like for my $base (#array) { ... }.