How to use pointer concepts in Perl? For example I have a line and want to search for the given string any where in the that line by positioning using the pointer. Kindly suggest me.
So I have 2 files with a key it like in 1st file I have data as in following columns with value in it as...
ID|Rating_Provider|Time|QualityRating z6Y1kWFT99|S&P_LONG|20110120 12:00:00 AM|NR z6Y1kWFT99|MOODY'S_LONG|20101101 12:00:00 AM|NR
and in 2nd file I have data as in following columns in it as...
ID|BBCMPSEC|QualityRating_S&P_LONG|Time_S&P_LONG|QualityRating_MOODY'S_LONG|Time_MOODY'S_LONG
Now finally I need to see the data as...
ID|BBCMPSEC|QualityRating_S&P_LONG|Time_S&P_LONG|QualityRating_MOODY'S_LONG|Time_MOODY'S_LONG z6Y1kWFT99|xxx|NR|20110120 12:00:00 AM.
ETA: Based on your comments, I would say that you'd be best off using Text::CSV. Take a look at the documentation, it is quite helpful. Basically, you would do something like:
use Text::CSV;
my $csv = Text::CSV->new({
binary => 1,
sep_char => "|",
});
open my $fh, "<", "inputfile" or die $!;
while (my $row = $csv->getline($fh)) {
# #$row now contains your row data
}
Old answer
"pointers" are not used in perl. I assume you mean the position of the match. There are several ways. You can use index if you do not need any regexes:
perl -lwe 'print index("foobar", "bar");'
If you do need a regex, perhaps for some more complicated matches, you can use the predefined variable #-, which stores the position where your match begins:
perl -lwe '$str = "foobar"; if ($str =~ /bar/) { print $-[0] }'
However, I suggest you tell us what it is you are trying to do. Using string offsets is not the best perl tool in the box, and I suspect there are much better ways of solving your problem.
Perhaps look at pos?
use strict;
use warnings;
my $str = 'foobarbaz';
$str =~ /bar/g;
print pos($str), "\n";
print substr( $str, pos($str) ), "\n";
pos($str) = pos($str) + 2;
print substr( $str, pos($str) ), "\n";
Related
First of I have to apologize for editing my initial post. But after I provide my code I did the question fuzzy.
So, I have this an array (#start_cod) containing lines separated by /n as follows:
print #start_cod;
tatatattataattatatttat
cacacacaacaccacaac
aaaaaaaaaaaaaaa
I need to remove the newlines and add ">text" ONLY at the beginning of the array as follow:
>text
tatatattataattatatttatcacacacaacaccacaacaaaaaaaaaaaaaaa
I tried:
s/\s+\z// for #start_cod;
print ">text#start_cod";
I tried also with chomp
chomp #start_cod;
print ">text#start_cod";
and
my #start_cod = split("\n",$start_cod);
$start_cod = join("",#start_cod);
print ">text$start_cod";
but I get
aaaaaaaaaaaaaaaaaaa>textcacacacacaacaccacaac>textaattatatattataattatatttat
Any suggestions on how to handle this in Perl Programming?
Here is my code which works 100%.
#!/usr/bin/perl
use strict;
use warnings;
use feature 'say';
my %alliloux =();
$/="\n>";
while (<>) {
s/>//g;
my ($onoma, #seq) = split (/\n/, $_);
my ($sp, $head) = split (/\./, $onoma);
push #{ $alliloux{$sp} }, join "\n", ">$onoma", #seq;
}
foreach my $sp (keys %alliloux) {
chomp $sp;
my ($head, $dna) = split(/\t/, $sp);
my #start_cod = substr($dna, 3);
say #start_cod;
Input file:
>name aaaaaaaaaaaaaaaaaa
>name2 acacacacacaacaccacaac
>namex aattatatattataattatatttat
output after Perl run
tatatattataattatatttat
cacacacaacaccacaac
aaaaaaaaaaaaaaa
Desired output:
>text
tatatattataattatatttatcacacacaacaccacaacaaaaaaaaaaaaaaa
If I understand your question correctly, this should do what you want:
use strict;
use warnings;
my #start_cod = (
'aaaaaaaaaaaaaaaaaa',
'acacacacacaacaccacaac',
'aattatatattataattatatttat',
);
print ">text\n", #start_cod, "\n";
The print first prints ">text" and a newline once, then you get the #start_cod items on a line, and the last "\n" makes sure you have a newline after the last element.
Output:
>text
aaaaaaaaaaaaaaaaaaacacacacacaacaccacaacaattatatattataattatatttat
You might want to see Read FASTA into Hash. It's the same problem and very close to the code I wrote before I read it. Also, there are modules on CPAN that can handle FASTA.
I think you want to combine the sequences that start with the same name, disregarding the numbers. The sequences shouldn't have interior whitespace. In your code, you are constantly adding whitespace. You even join on a newline. So, you go to the doctor and say "My arm hurts when I do this", and the doctor says "So don't do that". :)
When you run into these sort of problems, check the results of your operations at each step to see if you get what you expect. Here's a much simplified version of a program that I think does what you want. I've removed most of the data structure because they are complicating your process.
In short, read a line and remove the newline at the end. That's one source of your newlines. Then, extract the sequence and concatenate that to the previous sequence. When you join with newlines, you are adding newlines. So, don't do that:
use v5.14;
use warnings;
use Data::Dumper;
my %alliloux = ();
while (<DATA>) {
chomp; # get rid of that newline!
s/>//g;
# now split on whitespace, but only up to two parts.
# There's no array here.
my( $name, $seq ) = split /\s+/, $_, 2;
# remove the numbers at the end to get the prefix of the
# name.
my $prefix = $name =~ s/\d+\z//r;
# append the current sequence for this prefix to what we
# have already seen.f
$alliloux{$prefix} .= $seq;
}
say Dumper( \%alliloux );
foreach my $base ( keys %alliloux ) {
say ">text $alliloux{$base}";
}
__DATA__
>name aaa
>name2 cccc
>name99 aattaatt
You don't need the intermediate array. You can build up your string as you go. You don't need to have all the parts before you do that.
Now, to figure out where you might be going wrong, do a little at once. Ensure that you've extracted the right thing. It's handle to put characters around the variables you interpolate so you can see whitespace at the beginning or end:
while (<DATA>) {
chomp; # get rid of that newline!
s/>//g;
my( $name, $seq ) = split /\s+/, $_, 2;
say "Name: <$name>";
say "Seq: <$seq>"
}
Then, add another step, and ensure that works:
while (<DATA>) {
chomp; # get rid of that newline!
s/>//g;
my( $name, $seq ) = split /\s+/, $_, 2;
say "Name: <$name>";
say "Seq: <$seq>"
my $prefix = $name =~ s/\d+\z//r;
say "Prefix: <$prefix>";
}
Repeat this process for each step. Then, when you come with a question, you've pinpointed the point where things diverge. Here's the same technique in your program:
#!/usr/bin/perl
use strict;
use warnings;
use feature 'say';
while (<DATA>) {
s/>//g;
my ($onoma, #seq) = split (/\n/, $_);
say "Onoma: <$onoma>";
}
__DATA__
>name aaa
>name2 cccc
>name99 aattaatt
The output shows that you never had anything in #seq. You are splitting on a newline, but unless you've changed the default line ending, you'll only get a newline at the end:
Onoma: <name aaa>
Onoma: <name2 cccc>
Onoma: <name99 aattaatt>
Now there's nothing in #seq, so a line like join "\n", ">$onoma", #seq; is really just join "\n", ">$onoma". You could have seen that with a little checking.
The description lacks clarity of the problem.
By looking at the desired output the following code comes to mind. Please see if it does what you was looking for.
Even looking at your code it is not clear what you try to do -- some part of the code does not make much sense.
use strict;
use warnings;
use feature 'say';
my #start_cod;
while( <DATA> ) {
chomp;
next unless />\s?name.?\s+(.*)/;
push #start_cod, $1;
}
print ">text\n " . join('',#start_cod);
__DATA__
>name aaaaaaaaaaaaaaaaaa
>name2 acacacacacaacaccacaac
.
.
.
> namex aattatatattataattatatttat
I've written the following script because I need to do some cleanup in some files. I have a specific number of hex characters that needs to be changed into another set of hex characters (ie null to space, see below). I've written the following script, my problem is that it only replaces the first occurence and nothing else.
I've tried the /g just like a regular sed pattern but it doesnt work. Is there a way to do this and replace all matches?
(The reason i havent used a $line =~ s/... is because I think its neater and more maintainable that way, and this script will need to be accessed and run on occasion by others who may need to edit the hex values to be replaced). Another reason is because i need to change from 10+ hex values to an equivalent amount, so a huge one liner would be hard to read. Thank you in advance.
#!/usr/bin/perl
use strict;
use warnings;
my $filebase = shift || "testreplace.txt";
my $filefilter = shift || "testf";
open my $fh1, '>', 'testreplaceout';
# Iterate over file and read lines
open my $file1, '<', $filebase;
while (my $line = <$file1>)
{
chomp($line);
for ($line) {
s/\x00/\x20/g;
s/\x31/\x32/g;
}
print {$fh1} "$line \n";
}
/g will do what you want. If it doesn't seem to be working, add some debugging:
use Data::Dumper;
$Data::Dumper::Useqq = $Data::Dumper::Terse = 1;
And in your loop:
print Dumper($line);
for ($line) {
s/\x00/\x20/g;
s/\x31/\x32/g;
}
print Dumper($line);
Using tr with paired delimiters instead can be very readable/maintainable:
$line =~ tr[\x00\x31]
[\x20\x32];
Also, consider adding use autodie;
tr/// is probably your best bet here (since you are dealing with constant single character replacements). The following is a more generic solution.
my %replacements = (
'foo' => 'bar',
'bar' => 'baz',
);
my $pat = join '|', map quotemeta, keys(%replacement);
s/($pat)/$replacements{$1}/g;
Update: read comments for caveats of this answer.
Here's one way that'll allow you to keep your list of regex search/replaces at the top of your script nice and clean for ease of viewing and modification:
use warnings;
use strict;
my #re_list = (
['a', 'x'],
['b', 'y'],
);
while (my $line = <DATA>){
for my $re (#re_list){
$line =~ s/$re->[0]/$re->[1]/g;
}
print $line;
}
__DATA__
aaabbbccc
bbbcccddd
ababababa
Output:
xxxyyyccc
yyycccddd
xyxyxyxyx
I need to compare the big file(2GB) contains 22 million lines with the another file. its taking more time to process it while using Tie::File.so i have done it through 'while' but problem remains. see my code below...
use strict;
use Tie::File;
# use warnings;
my #arr;
# tie #arr, 'Tie::File', 'title_Nov19.txt';
# open(IT,"<title_Nov19.txt");
# my #arr=<IT>;
# close(IT);
open(RE,">>res.txt");
open(IN,"<input.txt");
while(my $data=<IN>){
chomp($data);
print"$data\n";
my $occ=0;
open(IT,"<title_Nov19.txt");
while(my $line2=<IT>){
my $line=$line2;
chomp($line);
if($line=~m/\b$data\b/is){
$occ++;
}
}
print RE"$data\t$occ\n";
}
close(IT);
close(IN);
close(RE);
so help me to reduce it...
Lots of things wrong with this.
Asides from the usual (lack of use strict, use warnings, use of 2-argument open(), not checking open() result, use of global filehandles), the specific problem in your case is that you are opening/reading/closing the second file once for every single line of the first. This is going to be very slow.
I suggest you open the file title_Nov19.txt once, read all the lines into an array or hash or something, then close it; and then you can open the first file, input.txt and walk along that once, comparing to things in the array so you don't have to reopen that second file all the time.
Futher I suggest you read some basic articles on style/etc.. as your question is likely to gain more attention if it's actually written in vaguely modern standards.
I tried to build a small example script with a better structure but I have to say, man, your problem description is really very unclear. It's important to not read the whole comparison file each time as #LeoNerd explained in his answer. Then I use a hash to keep track of the match count:
#!/usr/bin/env perl
use strict;
use warnings;
# cache all lines of the comparison file
open my $comp_file, '<', 'input.txt' or die "input.txt: $!\n";
chomp (my #comparison = <$comp_file>);
close $comp_file;
# prepare comparison
open my $input, '<', 'title_Nov19.txt' or die "title_Nov19.txt: $!\n";
my %count = ();
# compare each line
while (my $title = <$input>) {
chomp $title;
# iterate comparison strings
foreach my $comp (#comparison) {
$count{$comp}++ if $title =~ /\b$comp\b/i;
}
}
# done
close $input;
# output (sorted by count)
open my $output, '>>', 'res.txt' or die "res.txt: $!\n";
foreach my $comp (#comparison) {
print $output "$comp\t$count{$comp}\n";
}
close $output;
Just to get you started... If someone wants to further work on this: these were my test files:
title_Nov19.txt
This is the foo title
Wow, we have bar too
Nothing special here but foo
OMG, the last title! And Foo again!
input.txt
foo
bar
And the result of the program was written to res.txt:
foo 3
bar 1
Here's another option using memowe's (thank you) data:
use strict;
use warnings;
use File::Slurp qw/read_file write_file/;
my %count;
my $regex = join '|', map { chomp; $_ = "\Q$_\E" } read_file 'input.txt';
for ( read_file 'title_Nov19.txt' ) {
my %seen;
!$seen{ lc $1 }++ and $count{ lc $1 }++ while /\b($regex)\b/ig;
}
write_file 'res.txt', map "$_\t$count{$_}\n",
sort { $count{$b} <=> $count{$a} } keys %count;
Numerically-sorted output to res.txt:
foo 3
bar 1
An alternation regex which quotes meta characters (\Q$_\E) is built and used, so only one pass against the large file's lines is needed. The hash %seen is used to insure that the input words are only counted once per line.
Hope this helps!
Try this:
grep -i -c -w -f input.txt title_Nov19.txt > res.txt
Here is what I am trying to do:
I want to read a text file into an array of strings. I want the string to terminate when the file reads in a certain character (mainly ; or |).
For example, the following text
Would you; please
hand me| my coat?
would be put away like this:
$string[0] = 'Would you;';
$string[1] = ' please hand me|';
$string[2] = ' my coat?';
Could I get some help on something like this?
This will do it. The trick to using split while preserving the token you're splitting on is to use a zero-width lookback match: split(/(?<=[;|])/, ...).
Note: mctylr's answer (currently the top rated) isn't actually correct -- it will split fields on newlines, b/c it only works on a single line of the file at a time.
gbacon's answer using the input record separator ($/) is quite clever--it's both space and time efficient--but I don't think I'd want to see it in production code. Putting one split token in the record separator and the other in the split strikes me as a little too unobvious (you have to fight that with Perl ...) which will make it hard to maintain. I'm also not sure why he's deleting multiple newlines (which I don't think you asked for?) and why he's doing that only for the end of '|'-terminated records.
# open file for reading, die with error message if it fails
open(my $fh, '<', 'data.txt') || die $!;
# set file reading to slurp (whole file) mode (note that this affects all
# file reads in this block)
local $/ = undef;
my $string = <$fh>;
# convert all newlines into spaces, not specified but as per example output
$string =~ s/\n/ /g;
# split string on ; or |, using a zero-width lookback match (?<=) to preserve char
my (#strings) = split(/(?<=[;|])/, $string);
One way is to inject another character, like \n, whenever your special character is found, then split on the \n:
use warnings;
use strict;
use Data::Dumper;
while (<DATA>) {
chomp;
s/([;|])/$1\n/g;
my #string = split /\n/;
print Dumper(\#string);
}
__DATA__
Would you; please hand me| my coat?
Prints out:
$VAR1 = [
'Would you;',
' please hand me|',
' my coat?'
];
UPDATE: The original question posed by James showed the input text on a single line, as shown in __DATA__ above. Because the question was poorly formatted, others edited the question, breaking the 1 line into 2. Only James knows whether 1 or 2 lines was intended.
I prefer #toolic's answer because it deals with multiple separators very easily.
However, if you wanted to overly complicate things, you could always try:
#!/usr/bin/perl
use strict; use warnings;
my #contents = ('');
while ( my $line = <DATA> ) {
last unless $line =~ /\S/;
$line =~ s{$/}{ };
if ( $line =~ /^([^|;]+[|;])(.+)$/ ) {
$contents[-1] .= $1;
push #contents, $2;
}
else {
$contents[-1] .= $1;
}
}
print "[$_]\n" for #contents;
__DATA__
Would you; please
hand me| my coat?
Something along the lines of
$text = <INPUTFILE>;
#string = split(/[;!]/, $text);
should do the trick more or less.
Edit: I've changed "/;!/" to "/[;!]/".
Let Perl do half the work for you by setting $/ (the input record separator) to vertical bar, and then extract semicolon-separated fields:
#!/usr/bin/perl
use warnings;
use strict;
my #string;
*ARGV = *DATA;
$/ = "|";
while (<>) {
s/\n+$//;
s/\n/ /g;
push #string => $1 while s/^(.*;)//;
push #string => $_;
}
for (my $i = 0; $i < #string; ++$i) {
print "\$string[$i] = '$string[$i]';\n";
}
__DATA__
Would you; please
hand me| my coat?
Output:
$string[0] = 'Would you;';
$string[1] = ' please hand me|';
$string[2] = ' my coat?';
When I say simple, I mean, within an expression, so that I can stick it in as a value in a hash without preparing it first. I'll post my solution but I'm looking for a better one that reminds me less of VB. :)
How about
( split /\n/, $s )[0]
?
You don't have to worry about \n being not cross-platform because Perl is clever enough to take care of that.
This isn't as simple as you like, but being simple just to be short shouldn't always be the goal.
You can open a filehandle on a string (as a scalar reference) and treat it as a file to read the first line:
my $string = "Fred\nWilma\Betty\n";
open my($fh), "<", \$string or die ...; # reading from the data in $string
my $first_line = <$fh>; # gives "Fred"
close $fh;
If you really wanted to, I guess you could reduce this to an expression:
$hash{$key} = do { open my($fh), "<", \$string; scalar <$fh> };
No matter which method you choose, you can always make a subroutine to return the first line and then use the subroutine call in your hash assignment.
sub gimme_first_line { ... }
$hash{$key } = gimme_first_line( \$string );
($str =~ /\A(.*?)$/ms)[0];
For large strings, this will be faster than
(split /\n/, $str)[0]
as suggested by Manni. [Edit: removed erroneous mention of split /\n/, $str, 1.]
If you want to include the terminal \n if it is present, add \n? just before the closing paren in the regex.
substr($s, 0, index($s, $/) > -1 ? index($s, $/) || () )