How to read multiple lines from console in Perl?
I have used #a = <STDIN>; but I am unable to come out of that statement. Evertime I hit enter it goes to new line. I have read to hit ctrl+d to end the input but it does not seem to work.
Maybe a better idea would be a loop of some sort:
use strict;
use warnings;
my #a;
for(;;) {
my $input = <STDIN>;
last if not defined $input;
chomp $input;
push #a, $input;
}
This will end when you type in the Unix <EOF> (which is usually set to Ctrl-D by default).
You can use while loop,
my #a;
while (<STDIN>) {
/\S/ or last; # last line if empty
push #a, $_;
}
print #a;
It seems like you are on Windows. On Windows you have to hit Control-z on an empty line and then hit Enter.
Related
First of I have to apologize for editing my initial post. But after I provide my code I did the question fuzzy.
So, I have this an array (#start_cod) containing lines separated by /n as follows:
print #start_cod;
tatatattataattatatttat
cacacacaacaccacaac
aaaaaaaaaaaaaaa
I need to remove the newlines and add ">text" ONLY at the beginning of the array as follow:
>text
tatatattataattatatttatcacacacaacaccacaacaaaaaaaaaaaaaaa
I tried:
s/\s+\z// for #start_cod;
print ">text#start_cod";
I tried also with chomp
chomp #start_cod;
print ">text#start_cod";
and
my #start_cod = split("\n",$start_cod);
$start_cod = join("",#start_cod);
print ">text$start_cod";
but I get
aaaaaaaaaaaaaaaaaaa>textcacacacacaacaccacaac>textaattatatattataattatatttat
Any suggestions on how to handle this in Perl Programming?
Here is my code which works 100%.
#!/usr/bin/perl
use strict;
use warnings;
use feature 'say';
my %alliloux =();
$/="\n>";
while (<>) {
s/>//g;
my ($onoma, #seq) = split (/\n/, $_);
my ($sp, $head) = split (/\./, $onoma);
push #{ $alliloux{$sp} }, join "\n", ">$onoma", #seq;
}
foreach my $sp (keys %alliloux) {
chomp $sp;
my ($head, $dna) = split(/\t/, $sp);
my #start_cod = substr($dna, 3);
say #start_cod;
Input file:
>name aaaaaaaaaaaaaaaaaa
>name2 acacacacacaacaccacaac
>namex aattatatattataattatatttat
output after Perl run
tatatattataattatatttat
cacacacaacaccacaac
aaaaaaaaaaaaaaa
Desired output:
>text
tatatattataattatatttatcacacacaacaccacaacaaaaaaaaaaaaaaa
If I understand your question correctly, this should do what you want:
use strict;
use warnings;
my #start_cod = (
'aaaaaaaaaaaaaaaaaa',
'acacacacacaacaccacaac',
'aattatatattataattatatttat',
);
print ">text\n", #start_cod, "\n";
The print first prints ">text" and a newline once, then you get the #start_cod items on a line, and the last "\n" makes sure you have a newline after the last element.
Output:
>text
aaaaaaaaaaaaaaaaaaacacacacacaacaccacaacaattatatattataattatatttat
You might want to see Read FASTA into Hash. It's the same problem and very close to the code I wrote before I read it. Also, there are modules on CPAN that can handle FASTA.
I think you want to combine the sequences that start with the same name, disregarding the numbers. The sequences shouldn't have interior whitespace. In your code, you are constantly adding whitespace. You even join on a newline. So, you go to the doctor and say "My arm hurts when I do this", and the doctor says "So don't do that". :)
When you run into these sort of problems, check the results of your operations at each step to see if you get what you expect. Here's a much simplified version of a program that I think does what you want. I've removed most of the data structure because they are complicating your process.
In short, read a line and remove the newline at the end. That's one source of your newlines. Then, extract the sequence and concatenate that to the previous sequence. When you join with newlines, you are adding newlines. So, don't do that:
use v5.14;
use warnings;
use Data::Dumper;
my %alliloux = ();
while (<DATA>) {
chomp; # get rid of that newline!
s/>//g;
# now split on whitespace, but only up to two parts.
# There's no array here.
my( $name, $seq ) = split /\s+/, $_, 2;
# remove the numbers at the end to get the prefix of the
# name.
my $prefix = $name =~ s/\d+\z//r;
# append the current sequence for this prefix to what we
# have already seen.f
$alliloux{$prefix} .= $seq;
}
say Dumper( \%alliloux );
foreach my $base ( keys %alliloux ) {
say ">text $alliloux{$base}";
}
__DATA__
>name aaa
>name2 cccc
>name99 aattaatt
You don't need the intermediate array. You can build up your string as you go. You don't need to have all the parts before you do that.
Now, to figure out where you might be going wrong, do a little at once. Ensure that you've extracted the right thing. It's handle to put characters around the variables you interpolate so you can see whitespace at the beginning or end:
while (<DATA>) {
chomp; # get rid of that newline!
s/>//g;
my( $name, $seq ) = split /\s+/, $_, 2;
say "Name: <$name>";
say "Seq: <$seq>"
}
Then, add another step, and ensure that works:
while (<DATA>) {
chomp; # get rid of that newline!
s/>//g;
my( $name, $seq ) = split /\s+/, $_, 2;
say "Name: <$name>";
say "Seq: <$seq>"
my $prefix = $name =~ s/\d+\z//r;
say "Prefix: <$prefix>";
}
Repeat this process for each step. Then, when you come with a question, you've pinpointed the point where things diverge. Here's the same technique in your program:
#!/usr/bin/perl
use strict;
use warnings;
use feature 'say';
while (<DATA>) {
s/>//g;
my ($onoma, #seq) = split (/\n/, $_);
say "Onoma: <$onoma>";
}
__DATA__
>name aaa
>name2 cccc
>name99 aattaatt
The output shows that you never had anything in #seq. You are splitting on a newline, but unless you've changed the default line ending, you'll only get a newline at the end:
Onoma: <name aaa>
Onoma: <name2 cccc>
Onoma: <name99 aattaatt>
Now there's nothing in #seq, so a line like join "\n", ">$onoma", #seq; is really just join "\n", ">$onoma". You could have seen that with a little checking.
The description lacks clarity of the problem.
By looking at the desired output the following code comes to mind. Please see if it does what you was looking for.
Even looking at your code it is not clear what you try to do -- some part of the code does not make much sense.
use strict;
use warnings;
use feature 'say';
my #start_cod;
while( <DATA> ) {
chomp;
next unless />\s?name.?\s+(.*)/;
push #start_cod, $1;
}
print ">text\n " . join('',#start_cod);
__DATA__
>name aaaaaaaaaaaaaaaaaa
>name2 acacacacacaacaccacaac
.
.
.
> namex aattatatattataattatatttat
I have a problem about arithmetic expression in Perl.
I have already written the code but I couldn't fill inside of eval function.
Example:
>2+4
6
Another example:
>8-2*2
4
This is my program
#!/usr/bin/perl
print ">";
while (<>) {
eval(---------);
print "\n>";
}
You can chomp the input to remove the newline and use string eval.
#!/usr/bin/perl
print ">" ;
while (<>) {
chomp $_;
my $result = eval $_;
print "$result\n>";
}
Think about this: What happens when someone enters `rm *` at the prompt?
You aren't printing the result of eval. The calculation is being done, but you are just throwing it away and printing another prompt.
This should do as you want.
#!/usr/bin/perl
print ">" ;
while (<>) {
print eval, "\n>";
}
You can just write in that way:
#!/usr/bin/perl
print ">";
while (<>) {
print eval("$_");
print "\n>";
}
I need some help with following perl code.
#!perl -w
use strict;
use warnings;
open my $file, '<', 'ubb' or die $1;
my $spool = 0;
my #matchingLines;
while (<$file>) {
if (/GROUPS/i) {
$spool = 1;
next;
}
elsif (/SERVERS/i) {
$spool = 0;
print map { "$_" } #matchingLines;
#matchingLines = ();
}
if ($spool) {
push (#matchingLines, $_);
}
}
close ($file);
Output from that is shown below.
ADM LMID=GW_S4_1_PM,GW_S4_2_BM
GRPNO=1
ADM_TMS LMID=GW_S4_1_PM,GW_S4_2_BM
GRPNO=2
TMSNAME=TMS
ADM_1 LMID=GW_S4_1_PM
GRPNO=11
ADM_2 LMID=GW_S4_2_BM
GRPNO=12
DMWSG_Gateway_1 LMID=GW_S4_1_PM
GRPNO=101
ENVFILE="../GW_S4.Gateway.envfile"
DMWSG_Gateway_2 LMID=GW_S4_2_BM
GRPNO=201
ENVFILE="../GW_S4.Gateway.envfile"
DMWSG_1 LMID=GW_S4_1_PM
GRPNO=106
DMWSG_2 LMID=GW_S4_2_BM
GRPNO=206
But I only would like to get the first word of each line (e.g. ADM, ADM_TMS, ADM_1).
Note that the file has a lot of other lines above and below what's printed here. I only want to do this for lines that is in between GROUPS and SERVERS.
I would suggest 2 changes in your code
Note: Tested these with your sample data (plus other stuff) in your question.
I: Extract first word before push
Change this
push (#matchingLines, $_);
to
push (#matchingLines, /^(\S+)/);
This would push the first word of each line into the array, instead of the entire line.
Note that /^(\S+)/ is shorthand for $_ =~ /^(\S+)/. If you're using an explicit loop variable like in 7stud's answer, you can't use this shorthand, use the explicit syntax instead, say $line =~ /^(\S+)/ or whatever your loop variable is.
Of course, you can also use split function as suggested in 7stud's answer.
II: Change how you print
Change this
print map { "$_" } #matchingLines;
into
local $" = "\n";
print "#matchingLines \n";
$" specifies the delimiter used for list elements when the array is printed with print or say inside double quotes.
Alternatively, as per TLP's suggestion,
$\ = $/;
print for #lines;
or
print join("\n", #lines), "\n"
Note that $/ is the input record separator (newline by default), $\ is the output record separator (undefined by default). $\ is appended after each print command.
For more information on $/, $\, and $":
See perldoc perlvar (just use CTRL+F to find them in that page)
Or you can simply use perldoc -v '$/' etc on your console to get those information.
Note on readability
I don't think implicit regex matching i.e. /pattern/ is bad per se.
But matching against a variable, i.e. $variable =~ /pattern/ is more readable (as in you can immediately see there's a regex matching going on) and more beginner-friendly, at the cost of conciseness.
use strict;
use warnings;
use 5.014; #say()
my $fname = 'data.txt';
open my $INFILE, '<', $fname
or die "Couldn't open $fname: $!"; #-->Not $1"
my $recording_on = 0;
my #matching_lines;
for my $line (<$INFILE>) {
if ($line =~ /groups/i) {
$recording_on = 1;
next;
}
elsif ($line =~ /servers/i) {
say for #matching_lines; #say() is the same as print(), but it adds a newline at the end
#matching_lines = ();
$recording_on = 0;
}
if ($recording_on) {
my ($first_word, $trash) = split " ", $line, 2;
push #matching_lines, $first_word;
}
}
close $INFILE;
You can use the flip-flop operator (range) to select a part of your input. The idea of this operator is that it returns false until its LHS (left hand side) returns true, and after that it returns true until its RHS returns false, after which it is reset. It is somewhat like preserving a state.
Note that the edge lines are also included in the match, so we need to remove those. After that, use doubleDown's idea and push /^(\S+)/ onto an array. The nice thing about using this with push is that the capture regex returns an empty list if it fails, and this gives us a warning-free failure when the regex does not match.
use strict;
use warnings;
my #matches;
while (<>) {
if (/GROUPS/i .. /SERVERS/i) { # flip-flop remembers the matches
next if (/GROUPS/i or /SERVERS/i);
push #matches, /^(\S+)/;
}
}
# #matches should now contain the first words of those lines
#!/usr/bin/env perl
use Term::ReadKey;
ReadMode 4;
END {
ReadMode 0; # Reset tty mode before exiting
}
while (<>) {
$key = ReadKey(0);
$key == "\x04" and last; # Ctrl+D breaks the loop
print $key;
}
When I had it without the while loop, it was printing back what I typed in.
It doesn't even produce any output at the end (if it was buffering it or something). Like I'd run it and type a few letters and hit Ctrl+D. It prints nothing.
I'm trying to make a program to convert mouse scroll escape codes into keypresses. I hope I'm not barking up the wrong tree.
This line
while (<>)
reads a line from STDIN (assuming you ran the program with no command line arguments). Once a line has been read, it enters the body of the while loop. Whatever you typed up to and including the newline is now in $_.
Now, you press a key, it's stored in $key and numerically compared to CTRL-D. Since neither is numeric, they both end up being zero, the loop terminates.
This is why you should turn on warnings which would have told you:
Argument "^D" isn't numeric in numeric eq (==) at ./tt.pl line 15, line 1.
Argument "c" isn't numeric in numeric eq (==) at ./tt.pl line 15, line 1.
Of course, it would make sense to put the loop-termination condition where it belongs as well:
#!/usr/bin/env perl
use strict;
use warnings;
use Term::ReadKey;
ReadMode 4;
END {
ReadMode 0; # Reset tty mode before exiting
}
my $input;
{
local $| = 1;
while ((my $key = ReadKey(0)) ne "\x04") {
print $key;
$input .= $key;
}
}
print "'$input'\n";
Just replace the while condition to:
while(1) {
# ...
}
I'm reading this textfile to get ONLY the words in it and ignore all kind of whitespaces:
hello
now
do you see this.sadslkd.das,msdlsa but
i hoohoh
And this is my Perl code:
#!usr/bin/perl -w
require 5.004;
open F1, './text.txt';
while ($line = <F1>) {
#print $line;
#arr = split /\s+/, $line;
foreach $w (#arr) {
if ($w !~ /^\s+$/) {
print $w."\n";
}
}
#print #arr;
}
close F1;
And this is the output:
hello
now
do
you
see
this.sadslkd.das,msdlsa
but
i
hoohoh
The output is showing two newlines but I am expecting the output to be just words. What should I do to just get words?
You should always use strict and use warnings (in preference to the -w command-line qualifier) at the top of every Perl program, and declare each variable at its first point of use using my. That way Perl will tell you about simple errors that you may otherwise overlook.
You should also use lexical file handles with the three-parameter form of open, and check the status to make sure it succeeded. There is little point in explicitly closing an input file unless you expect your program to run for an appreciable time, as Perl will close all files for you on exit.
Do you really need to require Perl v5.4? That version is fifteen years old, and if there is anything older than that installed then you have a museum!
Your program would be better like this:
use strict;
use warnings;
open my $fh, '<', './text.txt' or die $!;
while (my $line = <$fh>) {
my #arr = split /\s+/, $line;
foreach my $w (#arr) {
if ($w !~ /^\s+$/) {
print $w."\n";
}
}
}
Note: my apologies. The warnings pragma and lexical file handles were introduced only in v5.6 so that part of my answer is irrelevant. The latest version of Perl is v5.16 and you really should upgrade
As Birei has pointed out, the problem is that, when the line has leading whitespace, there is a empty field before the first separator. Imagine if your data was comma-separated, then you would want Perl to report a leading empty field if the line started with a comma.
To extract all the non-space characters you can use a regular expression that does exactly that
my #arr = $line =~ /\S+/g;
and this can be emulated by using the default parameter for split which is a single quoted space (not a regular expression)
my #arr = $line =~ split ' ', $line;
In this case split behaves like the awk utility and discards any leading empty fields as you expected.
This is even simpler if you let Perl use the $_ variable in the read loop, as all of the parameters for split can be defaulted:
while (<F1>) {
my #arr = split;
foreach my $w (#arr) {
print "$w\n" if $w !~ /^\s+$/;
}
}
This line is the problem:
#arr=split(/\s+/,$line);
\s+ does a match just before the leading spaces. Use ' ' instead.
#arr=split(' ',$line);
I believe that in this line:
if(!($w =~ /^\s+$/))
You wanted to ask if there's nothing in this row - don't print it.
But the "+" in the REGEX actually force it to have at least 1 space.
If you change the "\s+" to "\s*", you'll see that it's working. because * is 0 occurrences or more ...