perl hash mapping/retrieval issues with split and select columns - perl

Perl find and replace multiple(huge) strings in one shot
P.S.This question is related to the answer for above question.
When I try to replace this code:
Snippet-1
open my $map_fh, '<', 'map.csv' or die $!;
my %replace = map { chomp; split /,/ } <$map_fh>;
close $map_fh;
with this code:
Snippet-2
my %replace = map { chomp; (split /,/)[0,1] } <$map_fh>;
even though the key exists (as in the dumper), exists statement doesn't return the value for the key.
For same input file, it works perfectly with just split alone (Snippet-1) whereas not returning anything when i select specific columns after split(Snippet-2).
Is there some integer/string datatype mess-up happening here?
Input Mapping File
483329,Buffalo
483330,Buffalo
483337,Buffalo
Script Output
$VAR1 = {
'483329' => 'Buffalo',
'46546' => 'Chicago_CW',
'745679' => 'W. Washington',
};
1 search is ENB
2 search is 483329 **expected Buffalo here**
3 search is 483330
4 search is 483337
Perl Code
open my $map_fh, '<', $MarketMapFile or die $!;
if ($MapSelection =~ /eNodeBID/i) {
my %replace = map { chomp; (split /,/)[0,1] } <$map_fh>;
use Data::Dumper;
print Dumper(\%replace);
}
close $map_fh;
my $csv = Text::CSV->new({ binary => 1, auto_diag => 1, eol => $/,quote_space => 0 });
my $tmpCSVFile = $CSVFile."tmp";
open my $in_fh, '<', $CSVFile or die $!;
open my $out_fh, '>', $tmpCSVFile or die $!;
my $cnt=1;
while (my $row = $csv->getline($in_fh)) {
my $search = $row->[5];
$search =~ s/[^[:print:]]+//g;
if ($MapSelection =~ /eNodeBID/i) {
$search =~ s/(...)-(...)-//g;
$search =~ s/\(M\)//g;
}
my $match = (exists $replace{$search}) ? $replace{$search} : undef;
print "\n$cnt search is $search ";
if (defined($match)) {
$match =~ s/[^[:print:]]+//g;
print "and match is $match";
}
push #$row, $match;
#print " match is $match";
$csv->print($out_fh, $row);
$cnt++;
}
# untie %replace;
close $in_fh;
close $out_fh;

You have a problem of scope. Your code:
if ($MapSelection =~ /eNodeBID/i) {
my %replace = map { chomp; (split /,/)[0,1] } <$map_fh>;
use Data::Dumper;
print Dumper(\%replace);
}
declares %replace within the if block. Move it outside so that it can also be seen by later code:
my %replace;
if ($MapSelection =~ /eNodeBID/i) {
%replace = map { chomp; (split /,/)[0,1] } <$map_fh>;
use Data::Dumper;
print Dumper(\%replace);
}
Putting use strict and use warnings at the top of your code helps you find these kinds of issues.
Also, you can just use my $match = $replace{$search} since it's equivalent to your ?: operation.

Always include use strict; and use warnings; at the top of EVERY perl script. If you had done that and been maintaining good coding practice with declaring your variables, you would've gotten error:
Global symbol "%replace" requires explicit package name at
That would've let you know there was a scoping issue with your code. One way to avoid that is to use a ternary in your initialization of %replace
my %replace = ($MapSelection =~ /eNodeBID/i)
? map { chomp; (split /,/)[0,1] } <$map_fh>
: ();

Related

subset fasta file using id file

I have been stuck with some script!
Well i made this script in 2008 and now i am using with some modifications and i get error!
#!/usr/bin/perl -w
use strict;
use Data::Dumper;
sub getSequences ($) {
my $file = $_[0];
open (INFILE, "<$file") || die "Error1 in opening in file: $file. $!\n";
my #lines = <INFILE>;
my $header; my %header2seq = ();
foreach my $line (#lines) {
chomp $line;
if ($line =~ /^(>.+)$/o) {
$header = $1;
}
else {$header2seq {$header} .= $line; }
}
#print %header2seq;
close (INFILE);
return (\%header2seq);
}
sub MakeSpList ($) {
my $sp_list = $_[0]; my %sp_names = ();
open (INFILE2, "<$sp_list") || die "Error2 in opening in file: $sp_list. $!\n";
my #sps = <INFILE2>;
foreach my $line (#sps) { chomp $line; $sp_names {$line} = 1; }
close (INFILE2);
#print Dumper (%sp_names);
return (\%sp_names);
}
sub CompareSpList2Sequences ($$$) {
my $ref_header2seq = $_[0] ; my $ref_sp_names = $_[1]; my $file = $_[2];
open (OUTFILE, ">$file.subdata") || die ("Error3 in opening out file: $file.subdata. $!\n");
foreach my $key (keys %$ref_header2seq) {
$key =~ m/^>([A-Z]+[0-9]+[A-Z+]).+$/o;
#print "$1\n";
my $header_sub = $1;
#print $header_sub, "\n";
#print $ref_sp_names, "\n";
if (exists $ref_sp_names -> {$header_sub}) {
my $seq = $ref_header2seq -> {$key};
print OUTFILE ">$key\n$seq\n";
}
}
close (OUTFILE);
return "42";
}
my $fasta_seqs = $ARGV[0]; my $sp_list = $ARGV[1];
my $ref_header2seq = getSequences ($fasta_seqs);
my $ref_sp_names = MakeSpList ($sp_list);
CompareSpList2Sequences ($ref_header2seq , $ref_sp_names, $fasta_seqs);
exit;
What i want to do is:
i have a fasta file with sequences:
YAL004W YAL004W SGDID:S000002136, Chr I from 140760-141407, Genome Release 64-2-1, Dubious ORF, "Dubious open reading frame; unlikely to encode a functional protein, based on available experimental and comparative sequence data; completely overlaps verified gene SSA1/YAL005C" ATGGGTGTCACCAGCGGTGGCCTTAACTTCAAAGATACCGTCTTCAATGGACAACAAAGAGACATCGAAAGTACCACCACCCAAGTCGAAAATCAAGACGTGTTCTTCCTTACCCTTCTTGTCCAAACCGTAAGCAATGGCAGCGGCGGTAGGTTCGTTAATAATACGCAAGACATTCAAACCAGCAATGGTACCAGCATCCTTGGTAGCTTGTCTTTGAGAATCGTTGAA
YAL005C SSA1 SGDID:S000000004, Chr I from 141431-139503, Genome Release 64-2-1, reverse complement, Verified ORF, "ATPase involved in protein folding and NLS-directed nuclear transport; member of HSP70 family; forms chaperone complex with Ydj1p; localized to nucleus, cytoplasm, and cell wall; 98% identical with paralog Ssa2p, but subtle differences between the two proteins provide functional specificity with respect to propagation of yeast [URE3] prions and vacuolar-mediated degradations of gluconeogenesis enzymes; general targeting factor of Hsp104p to prion fibrils" ATGTCAAAAGCTGTCGGTATTGATTTAGGTACAACATACTCGTGTGTTGCTCACTTTGCTAATGATCGTGTGGACATTATTGCCAACGATCAAGGTAACAGAACCACTCCATCTTTTGTCGCTTTCACTGACACTGAAAGATTGATTGGTGATGCTGCTAAGAATCAAGCTGCTATGAATCCTTCGAATACCGTTTTCGACGCTAAGCGTTTGATCGGTAGAAACTTCAAC
and i have another file with ID's:
YAL005C
YAL012W
I want to retrieve the sequences and the all header when match with ID's file.
but i get this error: don´t print anything!
Please can you help me?
Thanks in advance.
i already searched for other methods (and i can´t get the results either) but i really want to know about this error!
no bioperl please!
OK, so - line 45 is:
if (exists $ref_sp_names -> {$header_sub}) {
Your error is telling you that $header_sub is undefined. It's set by:
my $header_sub = $1;
Which follows:
$key =~ m/^(>[A-Z])\s.+$/o;
So - this means the regex isn't matching. I don't see any > in your sample data, so it can't match it. When the match fails, $1 is undefined, hence your error. What do you get out of your print $key statements?
I would also note - .+$ is most likely redundant. Likewise - the o flag - you probably don't want that either. http://perldoc.perl.org/perlre.html#Modifiers
have you tried using Bioperl? Here's some code to get you started.
#!/usr/bin/perl
use warnings;
use strict;
use Bio::SeqIO;
my $fasta = shift; #this will just push whatever in cli in.
my $seqio_obj = Bio::SeqIO->(-file => $fasta, -format => 'fasta');
while ( my $seq = $seqio_obj->next_seq){
print $seq->id . ' = ' . $seq->seq() . "\n";
#in here you can do your fasta handling with the seq obj
}

How to randomly pair items in a list

I have a list of Accession numbers that I want to pair randomly using a Perl script below:
#!/usr/bin/perl -w
use List::Util qw(shuffle);
my $file = 'randomseq_acc.txt';
my #identifiers = map { (split /\n/)[1] } <$file>;
chomp #identifiers;
#Shuffle them and put in a hash
#identifiers = shuffle #identifiers;
my %pairs = (#identifiers);
#print the pairs
for (keys %pairs) {
print "$_ and $pairs{$_} are partners\n";
but keep getting errors.
The accession numbers in the file randomseq_acc.txt are:
1094711
1586007
2XFX_C
Q27031.2
P22497.2
Q9TVU5.1
Q4N4N8.1
P28547.2
P15711.1
AAC46910.1
AAA98602.1
AAA98601.1
AAA98600.1
EAN33235.2
EAN34465.1
EAN34464.1
EAN34463.1
EAN34462.1
EAN34461.1
EAN34460.1
I needed to add the closing right curly brace to be able to compile the script.
As arrays are indexed from 0, (split /\n/)[1] returns the second field, i.e. what follows newline on each line (i.e. nothing). Change it to [0] to make it work:
my #identifiers = map { (split /\n/)[0] } <$file>; # Still wrong.
The diamond operator needs a file handle, not a file name. Use open to associate the two:
open my $FH, '<', $file or die $!;
my #identifiers = map { (split /\n/)[0] } <$FH>;
Using split to remove a newline is not common. I'd probably use something else:
map { /(.*)/ } <$FH>
# or
map { chomp; $_ } <$FH>
# or, thanks to ikegami
chomp(my #identifiers = <$FH>);
So, the final result would be something like the following:
#!/usr/bin/perl
use warnings;
use strict;
use List::Util qw(shuffle);
my $filename = '...';
open my $FH, '<', $filename or die $!;
chomp(my #identifiers = <$FH>);
my %pairs = shuffle(#identifiers);
print "$_ and $pairs{$_} are partners\n" for keys %pairs;

How to use Perl's File::Grep module

I am using the File::Grep module. I have following example:
#!/usr/bin/perl
use strict;
use warnings;
use File::Grep qw( fgrep fmap fdo );
my #matches = fgrep { 1.1.1 } glob "file.csv";
foreach my $str (#matches) {
print "$str\n";
}
But when I try to print $str value it gives me HEX value: GLOB(0xac2e78)
What's wrong with this code?
The documentation doesn't seem to be accurate, but judging from the source-code — http://cpansearch.perl.org/src/MNEYLON/File-Grep-0.02/Grep.pm — the list you get back from fgrep contains one element per file. Each element is a hash of the form
{
filename => $filename,
count => $num_matches_in_that_file,
matches => {
$line_number => $line,
...
}
}
I think it would be simpler to skip fgrep and its complicated return-value that has way more information than you want, in favor of fdo, which lets you just iterate over all lines of a file and do what you want:
fdo { my ( $file, $pos, $line ) = #_;
print $line if $line =~ m/1\.1\.1/;
} 'file.csv';
(Note that I removed the glob, by the way. There's not much point in writing glob "file.csv", since only one file can match that globstring.)
or even just dispense with this module and write:
{
open my $fh, '<', 'file.csv';
while (<$fh>) {
print if m/1\.1\.1/;
}
}
I assume you want to see all the lines in file.csv that contain 1.1.1?
The documentation for File::Grep isn't up to date, but this program will put into #lines all the matching lines from all the files (if there were more than one).
use strict;
use warnings;
use File::Grep qw/ fgrep /;
$File::Grep::SILENT = 0;
my #matches = fgrep { /1\.1\.1/ } 'file.csv';
my #lines = map {
my $matches = $_->{matches};
#{$matches}{ sort { $a <=> $b } keys %$matches};
} #matches;
print for #lines;
Update
The most Perlish way to do this is like so
use strict;
use warnings;
open my $fh, '<', 'file.csv' or die $!;
while (<$fh>) {
print if /1\.1\.1/;
}

Selecting records from a file based on keys from a second file

My first file looks like:
CHR id position
1 rs58108140 10583
1 rs189107123 10611
1 rs180734498 13302
1 rs144762171 13327
1 chr1:13957:D 13957
And my second file looks like:
CHR SNP POS RiskAl OTHER_ALLELE RAF logOR Pval
10 rs1999138 110140096 T C 0.449034245446375 0.0924443 1.09e-06
6 rs7741604 20839503 C A 0.138318264238111 0.127947 1.1e-06
8 rs1486006 82553172 G C 0.833130882716561 0.147456 1.12727730194884e-06
My script reads in the first file and stores it in an array, and then I would like to find rsIDs from column 2 of the first file that are in column 2 in the second file. I think I am having a problem with how I'm matching the expressions. Here is my script:
#! perl -w
use strict;
use warnings;
my $F = shift #ARGV;
my #snps;
open IN, "$F";
while (<IN>) {
next if m/CHR/;
my #L = split;
push #snps, [$L[0], $L[1], $L[2]] if $L[0] !~ m/[XY]/;
}
close IN;
open IN, "DIAGRAMv3sansWTCCCqc0clumpd_noTCF7L2regOrLeadOrPlt1em6clumps- CHR_SNP_POS_RiskAl_OtherAl_RAF_logOR_Pval.txt";
while (<IN>) {
my #L = split;
next if m/CHR/;
foreach (#snps) {
next if ($L[0] != ${$_}[0]);
# if not on same chromosome
if ($L[0] = ${$_}[0]) {
# if on same chromosome
if ($L[1] =~ ${$_}[1]) {
print "$L[0] $L[1] ${$_}[2]\n";
last;
}
}
}
}
Your code doesn't seem to correspond to your description. You are comparing both the first and second columns of the file rather than just the second.
The main problems are:
You use $L[0] = ${$_}[0] to compare the first columns. This will do an assigmment instead of a comparison. You should use $L[0] == ${$_}[0] instead or, better, $L[0] == $_->[0]
You use $L[1] =~ ${$_}[1] to compare the second columns. This will check whether ${$_}[1] is a substring of $L[1]. You could use anchors like $L[1] =~ /^${$_}[1]$/ but it's much better to just do a string comparison as $L[1] eq $_->[1]
The easiest way is to read the second file first so as to build a list of values that you want included from the first file. I have written it so that it does what your code looks like it's supposed to do, i.e. match the first two columns.
That would look like this
use strict;
use warnings;
use autodie;
my ($f1, $f2) = #_;
my %include;
open my $fh2, '<', $f2;
while (<$fh2>) {
my #fields = split;
my $key = join '|', #fields[0,1];
++$include{$key};
}
close $fh2;
open my $fh1, '<', $f1;
while (<$fh1>) {
my #fields = split;
my $key = join '|', #fields[0,1];
print "#fields[0,1,2]\n" if $include{$key};
}
close $fh1;
output
Unfortunately your choice of sample data doesn't include any records in the first file that have matching keys in the second, so there is no output!
Update
This is a corrected version of your own program. It should work, but it is far more efficient and concise to use hashes, as above
use strict;
use warnings;
use autodie;
my ($filename) = #ARGV;
my #snps;
open my $in_fh, '<', $filename;
<$in_fh>; # Discard header line
while (<$in_fh>) {
my #fields = split;
push #snps, \#fields unless $fields[0] =~ /[XY]/;
}
close $in_fh;
open $in_fh, '<', 'DIAGRAMv3sansWTCCCqc0clumpd_noTCF7L2regOrLeadOrPlt1em6clumps- CHR_SNP_POS_RiskAl_OtherAl_RAF_logOR_Pval.txt';
<$in_fh>; # Discard header line
while (<$in_fh>) {
my #fields = split;
for my $snp (#snps) {
next unless $fields[0] == $snp->[0] and $fields[1] eq $snp->[1];
print "$fields[0] $fields[1] $snp->[2]\n";
last;
}
}
close $in_fh;

Degeneracy of characters when searching for a specific sub-string

I have the following script which searches for specified substrings within an input string (a DNA sequence). I was wondering if anybody could help out with being able to specify degeneracy of specific characters. For example, instead of searching for GATC (or anything consisting solely of G's, T's, A's and C's), I could instead search for GRTNA where R = A or G and where N = A, G, C or T. I would need to be able to specify quite a few of these in a long list within the script. Many thanks for any help or tips!
use warnings;
use strict;
#User Input
my $usage = "Usage (OSX Terminal): perl <$0> <FASTA File> <Results Directory + Filename>\n";
#Reading formatted FASTA/FA files
sub read_fasta {
my ($in) = #_;
my $sequence = "";
while(<$in>) {
my $line = $_;
chomp($line);
if($line =~ /^>/){ next }
else { $sequence .= $line }
}
return(\$sequence);
}
#Scanning for restriction sites and length-output
open(my $in, "<", shift);
open(my $out, ">", shift);
my $DNA = read_fasta($in);
print "DNA is: \n $$DNA \n";
my $len = length($$DNA);
print "\n DNA Length is: $len \n";
my #pats=qw( GTTAAC );
for (#pats) {
my $m = () = $$DNA =~ /$_/gi;
print "\n Total DNA matches to $_ are: $m \n";
}
my $pat=join("|",#pats);
my #cutarr = split(/$pat/, $$DNA);
for (#cutarr) {
my $len = length($_);
print $out "$len \n";
}
close($out);
close($in);
GRTNA would correspond to the pattern G[AG]T[AGCT]A.
It looks like you could do this by writing
for (#pats) {
s/R/[AG]/g;
s/N/[AGCT]/g;
}
before
my $pat = join '|', #pats;
my #cutarr = split /$pat/, $$DNA;
but I'm not sure I can help you with the requirement that "I would need to be able to specify quite a few of these in a long list within the script". I think it would be best to put your sequences in a separate text file rather than embed the list directly into the program.
By the way, wouldn't it be simpler just to
return $sequence
from your read_fasta subroutine? Returning a reference just means you have to dereference it everywhere with $$DNA. I suggest that it should look like this
sub read_fasta {
my ($fh) = #_;
my $sequence;
while (<$fh>) {
unless (/^>/) {
chomp;
$sequence .= $_;
}
}
return $sequence;
}