I'm trying to find the number of positive (P) and negative integers (N), number of words with all lower case characters(L),all upper case characters(F), Number of words with the first character capital and the rest of characters lower case(U).
List of words in alphabetical order together with the line number and the filename of each occurrence The following example illustrates the output of the program on sample input.
file1
Hello! world my friend. ALI went to school. Ali has -1 dollars and 10 TL
file2
Hello there my friend. VELI went to school. Veli has 10,
dollars and -10,TL
After you run your program,
>prog.pl file1 file2
the output you get is as follows:
N=2
P=2
L=18
F=4
U=4
-----------
ali file1 (1 1)
and file1 (2) file2 (2)
dollars file1 (2) file2 (2)
friend file1 (1) file2 (1)
has file1 (1) file2 (1)
hello file1 (1) file2 (1)
my file1 (1) file2 (1)
school file1 (1) file2 (1)
there file2 (1)
tl file1 (2) file2 (2)
to file1 (1) file2 (1)
veli file2 (1 1)
went file1 (1) file2 (1)
world file1 (1)
I tried to fill the entries,could you help me to deal with it?
#!/usr/bin/perl
$N= 0 ;
$P= 0 ;
$L= 0 ;
$F= 0 ;
$U= 0 ;
foreach __________ ( ____________) {__________________
or die("Cannot opened because: $!") ;
$lineno = 0 ;
while($line=<>) {
chomp ;
$lineno++ ;
#tokens = split $line=~ (/[ ,.:;!\?]+/) ;
foreach $str (#tokens) {
$N++ if ($str =~ /^-\d+$/) ;
$P++ if ($str =~ /^\d+$/) ;
$L++ if ($str =~ /^[a-z]+$/) ;
$F++ if ($str =~ /^[A-Z][a-z]+$/) ;
$U++ if ($str =~ /^[A-Z]+$/) ;
if ($str =~ /^[a-zA-Z]+$/) {
$str =~ __________________;
if ( (____________________) || ($words{$str} =~ /\)$/ ) ) {
$words{$str} = $words{$str} . " " . $file . " (" . $lineno ;
}
else {_______________________________________;
}}}}
close(FH) ;
foreach $w (__________________) {
if ( ! ($words{$w} =~ /\)$/ )) {
$words{$w} = ______________________;
}}}
print "N=$N\n" ;
print "P=$P\n" ;
print "L=$L\n" ;
print "F=$F\n" ;
print "U=$U\n" ;
print "-----------\n" ;
foreach $w (sort(keys(%words))) {
print $w," ", $words{$w}, "\n";
}
A few hints, and I'll let you get on your way...
Perl has what is called a diamond operator. This operator opens all files placed on the command line (which is read into the #ARGS array), and reads them line-by-line.
use strict;
use warnings;
use autodie;
use feature qw(say);
while my $line ( <> ) {
chomp $line;
say "The line read in is '$line'";
}
Try this program and run it as you would your program. See what happens.
Next, take a look at the Perl documentation for variables related to file handles. Especially take a look at the $/ variable. This variable is what used to break records. It's normally set to a new-line, so when you read in a file, you read it in line-by-line. You may want to try that. If not, you can fall back onto something like this:
use strict;
use warnings;
use autodie;
use feature qw(say);
while my $line ( <> ) {
chomp $line;
#words = split /\s+/, $line;
for my $word ( #words ) {
say "The word is '$word'";
}
}
Now you can use a hash to track which words were in each file and how many times. You can also track the various types of words you've mentioned. However, please don't use variables such as $U. Use $first_letter_uppercase. This will have more meaning in your program and will be less confusing for you.
Your teacher is teaching you the way Perl was written almost 30 years ago. This was back before God created the Internet. (Well, not quite. The Internet was already 10 years old, but no one outside of a few academics had heard of it). Perl programming has greatly evolved since then. Get yourself a good book on Modern Perl (that is Perl 5.x).
The pragmas at the beginning of my program (the use statements) do the following:
use strict - Use strict syntax. This does several things, but the main thing is to make sure you cannot use a variable unless you first declare it. (using most likely my). This prevents mistakes such as putting $name in one place, and referring to $Name in another place.
use warnings - This warns you of basic errors such as you're attempting to use a variable that isn't defined. By default, Perl assumes the variable is a null string or equal to zero if you use it in an arithmetic context. When you attempt to print or check a variable that hasn't been assigned a value. It probably means you have a logic mistake.
The above two pragmas will catch 90% of your errors.
use autodie - This will cause your program to automatically die in many circumstances. For example, you attempt to open a none existent file for reading. This way, you don't have to remember to check each instance of whether or not certain operations succeeded of failed.
use feature qw(say) - This allows you to use say instead of print. The say command is just like print, but automatically adds a new line on the end. It can make your code way cleaner and easier to understand.
For example:
print "N=$N\n" ;
vs.
say "N=$N" ;
Here's how I'd write that program. But it won't get you many marks as it's a long way from the "fill in the blanks" approach that your teacher is using. But that's good, because your teacher's Perl is very dated.
#!/usr/bin/perl
use strict;
use warnings;
use 5.010;
my ($N, $P, $L, $F, $U);
my %words;
while (<>) {
my #tokens = split /[^-\w]+/;
foreach my $token (#tokens) {
$N++ if $token =~ /^-\d+$/;
$P++ if $token =~ /^\d+$/;
next unless $token =~ /[a-z]/i;
$L++ if $token eq lc $token;
$U++ if $token eq uc $token;
$F++ if $token eq ucfirst lc $token;
push #{$words{lc $token}{$ARGV}}, $.;
}
close ARGV if eof;
}
say "N=$N";
say "P=$P";
say "L=$L";
say "F=$F";
say "U=$U";
for my $word (sort { $a cmp $b } keys %words) {
print "$word ";
for my $file (sort { $a cmp $b } keys %{$words{$word}} ) {
print "$file (", join(' ', #{$words{$word}{$file}}), ') ';
}
print "\n";
}
Related
First of I have to apologize for editing my initial post. But after I provide my code I did the question fuzzy.
So, I have this an array (#start_cod) containing lines separated by /n as follows:
print #start_cod;
tatatattataattatatttat
cacacacaacaccacaac
aaaaaaaaaaaaaaa
I need to remove the newlines and add ">text" ONLY at the beginning of the array as follow:
>text
tatatattataattatatttatcacacacaacaccacaacaaaaaaaaaaaaaaa
I tried:
s/\s+\z// for #start_cod;
print ">text#start_cod";
I tried also with chomp
chomp #start_cod;
print ">text#start_cod";
and
my #start_cod = split("\n",$start_cod);
$start_cod = join("",#start_cod);
print ">text$start_cod";
but I get
aaaaaaaaaaaaaaaaaaa>textcacacacacaacaccacaac>textaattatatattataattatatttat
Any suggestions on how to handle this in Perl Programming?
Here is my code which works 100%.
#!/usr/bin/perl
use strict;
use warnings;
use feature 'say';
my %alliloux =();
$/="\n>";
while (<>) {
s/>//g;
my ($onoma, #seq) = split (/\n/, $_);
my ($sp, $head) = split (/\./, $onoma);
push #{ $alliloux{$sp} }, join "\n", ">$onoma", #seq;
}
foreach my $sp (keys %alliloux) {
chomp $sp;
my ($head, $dna) = split(/\t/, $sp);
my #start_cod = substr($dna, 3);
say #start_cod;
Input file:
>name aaaaaaaaaaaaaaaaaa
>name2 acacacacacaacaccacaac
>namex aattatatattataattatatttat
output after Perl run
tatatattataattatatttat
cacacacaacaccacaac
aaaaaaaaaaaaaaa
Desired output:
>text
tatatattataattatatttatcacacacaacaccacaacaaaaaaaaaaaaaaa
If I understand your question correctly, this should do what you want:
use strict;
use warnings;
my #start_cod = (
'aaaaaaaaaaaaaaaaaa',
'acacacacacaacaccacaac',
'aattatatattataattatatttat',
);
print ">text\n", #start_cod, "\n";
The print first prints ">text" and a newline once, then you get the #start_cod items on a line, and the last "\n" makes sure you have a newline after the last element.
Output:
>text
aaaaaaaaaaaaaaaaaaacacacacacaacaccacaacaattatatattataattatatttat
You might want to see Read FASTA into Hash. It's the same problem and very close to the code I wrote before I read it. Also, there are modules on CPAN that can handle FASTA.
I think you want to combine the sequences that start with the same name, disregarding the numbers. The sequences shouldn't have interior whitespace. In your code, you are constantly adding whitespace. You even join on a newline. So, you go to the doctor and say "My arm hurts when I do this", and the doctor says "So don't do that". :)
When you run into these sort of problems, check the results of your operations at each step to see if you get what you expect. Here's a much simplified version of a program that I think does what you want. I've removed most of the data structure because they are complicating your process.
In short, read a line and remove the newline at the end. That's one source of your newlines. Then, extract the sequence and concatenate that to the previous sequence. When you join with newlines, you are adding newlines. So, don't do that:
use v5.14;
use warnings;
use Data::Dumper;
my %alliloux = ();
while (<DATA>) {
chomp; # get rid of that newline!
s/>//g;
# now split on whitespace, but only up to two parts.
# There's no array here.
my( $name, $seq ) = split /\s+/, $_, 2;
# remove the numbers at the end to get the prefix of the
# name.
my $prefix = $name =~ s/\d+\z//r;
# append the current sequence for this prefix to what we
# have already seen.f
$alliloux{$prefix} .= $seq;
}
say Dumper( \%alliloux );
foreach my $base ( keys %alliloux ) {
say ">text $alliloux{$base}";
}
__DATA__
>name aaa
>name2 cccc
>name99 aattaatt
You don't need the intermediate array. You can build up your string as you go. You don't need to have all the parts before you do that.
Now, to figure out where you might be going wrong, do a little at once. Ensure that you've extracted the right thing. It's handle to put characters around the variables you interpolate so you can see whitespace at the beginning or end:
while (<DATA>) {
chomp; # get rid of that newline!
s/>//g;
my( $name, $seq ) = split /\s+/, $_, 2;
say "Name: <$name>";
say "Seq: <$seq>"
}
Then, add another step, and ensure that works:
while (<DATA>) {
chomp; # get rid of that newline!
s/>//g;
my( $name, $seq ) = split /\s+/, $_, 2;
say "Name: <$name>";
say "Seq: <$seq>"
my $prefix = $name =~ s/\d+\z//r;
say "Prefix: <$prefix>";
}
Repeat this process for each step. Then, when you come with a question, you've pinpointed the point where things diverge. Here's the same technique in your program:
#!/usr/bin/perl
use strict;
use warnings;
use feature 'say';
while (<DATA>) {
s/>//g;
my ($onoma, #seq) = split (/\n/, $_);
say "Onoma: <$onoma>";
}
__DATA__
>name aaa
>name2 cccc
>name99 aattaatt
The output shows that you never had anything in #seq. You are splitting on a newline, but unless you've changed the default line ending, you'll only get a newline at the end:
Onoma: <name aaa>
Onoma: <name2 cccc>
Onoma: <name99 aattaatt>
Now there's nothing in #seq, so a line like join "\n", ">$onoma", #seq; is really just join "\n", ">$onoma". You could have seen that with a little checking.
The description lacks clarity of the problem.
By looking at the desired output the following code comes to mind. Please see if it does what you was looking for.
Even looking at your code it is not clear what you try to do -- some part of the code does not make much sense.
use strict;
use warnings;
use feature 'say';
my #start_cod;
while( <DATA> ) {
chomp;
next unless />\s?name.?\s+(.*)/;
push #start_cod, $1;
}
print ">text\n " . join('',#start_cod);
__DATA__
>name aaaaaaaaaaaaaaaaaa
>name2 acacacacacaacaccacaac
.
.
.
> namex aattatatattataattatatttat
I have a file which has data like this:
1 unknown state 3204563 3207049 . - . name "gosford"; school_name "gosford"; pupil_id "P15240"; transcript_id "NM_001011874.1"; tss_id "TSS13146";
I want to read it line by line into a hash, and then split it with regular expressions. so that i can count the number of schools.]
so far i have:
my$schools;
open (SCHOOLS, <"$schools) or die (Cannot open $schools");
while <SCHOOLS> {
chomp;
my ($val, $key) = split /(^\d)\s+\w+\s+\W+\s+\d+\s+\d+\s+\d+\.\s+\+\s+\.\s+.. and so on);
}
How do I get the values I've split into the hash, and then manipulate them so produce some basic statistics?
It's a bit unclear what you're after, but I will offer - you are doing things the hard way using a long regex to match the line. Also, for 'other things' it's quite hard to tell exactly what you have in mind. But grep is your friend, as it lets you specify search terms.
Something like this will do the trick. I've used a simplistic example for counting entries matching a particular criterion. Of course, given you've only given us one row, this is a bit of a guess:
#!/usr/bin/env perl
use strict;
use warnings;
use Data::Dumper;
my #entries;
my #keys = qw ( id thing state firstnum secondnum );
while ( <DATA> ) {
my %attributes = m/(\w+) "(\w+)"/g;
#attributes{#keys} = split;
push #entries, \%attributes;
}
print Dumper \#entries;
print "count of things: ", scalar #entries, "\n";
print "There are ", (scalar grep { $_ -> {state} eq "state" } #entries), " things with a state of 'state'\n";
__DATA__
1 unknown state 3204563 3207049 . - . name "gosford"; school_name "gosford"; pupil_id "P15240"; transcript_id "NM_001011874.1"; tss_id "TSS13146";
I'll also point out - it's much better form to use lexical filehandles with 3 arg open. E.g.
open ( my $schools, '<', 'schools.txt' ) or die $!;
while ( <$schools> ) {
#etc.
}
I'm using the special filehandle __DATA__ for illustrative purposes.
I'm trying to edit a text using Perl. I need to make a substitution but the substitution cannot be applied once an specific word is found in the text. So, imagine I want to substitute all the "hello" forms by "goodbye", but the substitution cannot be applied once the word "foo" is found.
I tried to do this:
use warnings;
use strict;
$/ = undef;
my $filename = shift;
open F, $filename or die "Usa: $0 FILENAME\n";
while(<F>) {
do {s/hello/goodbay/} until (m{foo});
print;
}
close F;
But, as a result, only the first "hello" of my text is changed.
Any suggestion?
Trying to think what would be the most efficient. It should be one of the following:
s{^(.*?)(foo|\z)}{
my $s = $1;
$s =~ s{hello}{goodbay}g;
$s.$2
}se;
print;
or (same as above, but requires 5.14+)
s{^(.*?)(foo|\z)}{ s{hello}{goodbay}gr . $2 }se;
print;
or
my $pos = /foo/ ? $-[0] : length;
my $s = substr($_, 0, $pos, '');
$s =~ s{hello}{goodbay}g;
print($s);
print;
Both work even if foo isn't present.
This solution uses less memory:
# Assumes foo will always be present
# (though it could be expanded to handle that
# Assumes foo isn't a regex pattern.
local $/ = "foo";
$_ = <$fh>;
chomp;
s{hello}{goodbay}g;
print;
print $/;
local $/;
print <$fh>;
If the substrings you work on (the hello and foo of your example) are single words, a easy way would probably be to replace $/ = undef; with $/ = " ";. Currently you slurp in the whole file at once, meaning the while loop gets executed at most once.
That is because there is only one "line" in the whole input after you told perl that there are no line separators.
If you use a space as input separator, it will loop over the input word by word and hopefully work as you intend.
Use a flag variable:
use warnings;
use strict;
my $filename = shift;
open F, $filename or die "Usa: $0 FILENAME\n";
my $replace=1;
while(<F>) {
$replace = 0 if m{foo};
s/hello/goodbye/g if $replace;
print;
}
close F;
This stops at the line containing the end pattern. It will be slightly more complicated if you want to substitute up to just before the match.
This answer uses the ${^PREMATCH] and related variables introduced in Perl 5.10.
#!/usr/bin/env perl
use v5.10.0;
use strict;
use warnings;
my $foo_found;
while (my $line = <>) {
if (!$foo_found) {
if ($line =~ m/foo/ip) {
# only replace hellos in the part before foo
${^PREMATCH} =~ s/hello/goodbye/g;
$line = "${^PREMATCH}${^MATCH}${^POSTMATCH}";
$foo_found ++;
} else {
$line =~ s/hello/goodbye/ig;
}
}
print $line;
}
Given the following input:
hello cruel world
hello baseball
hello mudda, hello fadda
foo
The rest of the hellos should stay
Last hello
I get the following output
goodbye cruel world
goodbye baseball
goodbye mudda, goodbye fadda
foo
The rest of the hellos should stay
Last hello
If you don't have 5.10 you can use $` and related variables but they come with a performance hit. See perldoc perlvar for details.
Another question for everyone. To reiterate I am very new to the Perl process and I apologize in advance for making silly mistakes
I am trying to calculate the GC content of different lengths of DNA sequence. The file is in this format:
>gene 1
DNA sequence of specific gene
>gene 2
DNA sequence of specific gene
...etc...
This is a small piece of the file
>env
ATGCTTCTCATCTCAAACCCGCGCCACCTGGGGCACCCGATGAGTCCTGGGAA
I have established the counter and to read each line of DNA sequence but at the moment it is do a running summation of the total across all lines. I want it to read each sequence, print the content after the sequence read then move onto the next one. Having individual base counts for each line.
This is what I have so far.
#!/usr/bin/perl
#necessary code to open and read a new file and create a new one.
use strict;
my $infile = "Lab1_seq.fasta";
open INFILE, $infile or die "$infile: $!";
my $outfile = "Lab1_seq_output.txt";
open OUTFILE, ">$outfile" or die "Cannot open $outfile: $!";
#establishing the intial counts for each base
my $G = 0;
my $C = 0;
my $A = 0;
my $T = 0;
#initial loop created to read through each line
while ( my $line = <INFILE> ) {
chomp $line;
# reads file until the ">" character is encounterd and prints the line
if ($line =~ /^>/){
print OUTFILE "Gene: $line\n";
}
# otherwise count the content of the next line.
# my percent counts seem to be incorrect due to my Total length counts skewing the following line. I am currently unsure how to fix that
elsif ($line =~ /^[A-Z]/){
my #array = split //, $line;
my $array= (#array);
# reset the counts of each variable
$G = ();
$C = ();
$A = ();
$T = ();
foreach $array (#array){
#if statements asses which base is present and makes a running total of the bases.
if ($array eq 'G'){
++$G;
}
elsif ( $array eq 'C' ) {
++$C; }
elsif ( $array eq 'A' ) {
++$A; }
elsif ( $array eq 'T' ) {
++$T; }
}
# all is printed to the outfile
print OUTFILE "G:$G\n";
print OUTFILE "C:$C\n";
print OUTFILE "A:$A\n";
print OUTFILE "T:$T\n";
print OUTFILE "Total length:_", ($A+=$C+=$G+=$T), "_base pairs\n";
print OUTFILE "GC content is(percent):_", (($G+=$C)/($A+=$C+=$G+=$T)*100),"_%\n";
}
}
#close the outfile and the infile
close OUTFILE;
close INFILE;
Again I feel like I am on the right path, I am just missing some basic foundations. Any help would be greatly appreciated.
The final problem is in the final counts printed out. My percent values are wrong and give me the wrong value. I feel like the total is being calculated then that new value is incorporated into the total.
Several things:
1. use hash instead of declaring each element.
2. assignment such as $G = (0); is indeed working, but it is not the right way to assign scalar. What you did is declaring an array, which in scalar context $G = is returning the first array item. The correct way is $G = 0.
my %seen;
$seen{/^([A-Z])/}++ for (grep {/^\>/} <INFILE>);
foreach $gene (keys %seen) {
print "$gene: $seen{$gene}\n";
}
Just reset the counters when a new gene is found. Also, I'd use hashes for the counting:
use strict; use warnings;
my %counts;
while (<>) {
if (/^>/) {
# print counts for the prev gene if there are counts:
print_counts(\%counts) if keys %counts;
%counts = (); # reset the counts
print $_; # print the Fasta header
} else {
chomp;
$counts{$_}++ for split //;
}
}
print_counts(\%counts) if keys %counts; # print counts for last gene
sub print_counts {
my ($counts) = #_;
print "$_:=", ($counts->{$_} || 0), "\n" for qw/A C G T/;
}
Usage: $ perl count-bases.pl input.fasta.
Example output:
> gene 1
A:=3
C:=1
G:=5
T:=5
> gene 2
A:=1
C:=5
G:=0
T:=13
Style comments:
When opening a file, always use lexical filehandles (normal variables). Also, you should do a three-arg open. I'd also recommend the autodie pragma for automatic error handling (since perl v5.10.1).
use autodie;
open my $in, "<", $infile;
open my $out, ">", $outfile;
Note that I don't open files in my above script because I use the special ARGV filehandle for input, and print to STDOUT. The output can be redirected on the shell, like
$ perl count-bases.pl input.fasta >counts.txt
Declaring scalar variables with their values in parens like my $G = (0) is weird, but works fine. I think this is more confusing than helpful. → my $G = 0.
Your intendation is a bit weird. It is very unusual and visually confusing to put closing braces on the same line with another statement like
...
elsif ( $array eq 'C' ) {
++$C; }
I prefer cuddling elsif:
...
} elsif ($base eq 'C') {
$C++;
}
This statement my $array= (#array); puts the length of the array into $array. What for? Tip: You can declare variables right inside foreach-loops, like for my $base (#array) { ... }.
Here is what I am trying to do:
I want to read a text file into an array of strings. I want the string to terminate when the file reads in a certain character (mainly ; or |).
For example, the following text
Would you; please
hand me| my coat?
would be put away like this:
$string[0] = 'Would you;';
$string[1] = ' please hand me|';
$string[2] = ' my coat?';
Could I get some help on something like this?
This will do it. The trick to using split while preserving the token you're splitting on is to use a zero-width lookback match: split(/(?<=[;|])/, ...).
Note: mctylr's answer (currently the top rated) isn't actually correct -- it will split fields on newlines, b/c it only works on a single line of the file at a time.
gbacon's answer using the input record separator ($/) is quite clever--it's both space and time efficient--but I don't think I'd want to see it in production code. Putting one split token in the record separator and the other in the split strikes me as a little too unobvious (you have to fight that with Perl ...) which will make it hard to maintain. I'm also not sure why he's deleting multiple newlines (which I don't think you asked for?) and why he's doing that only for the end of '|'-terminated records.
# open file for reading, die with error message if it fails
open(my $fh, '<', 'data.txt') || die $!;
# set file reading to slurp (whole file) mode (note that this affects all
# file reads in this block)
local $/ = undef;
my $string = <$fh>;
# convert all newlines into spaces, not specified but as per example output
$string =~ s/\n/ /g;
# split string on ; or |, using a zero-width lookback match (?<=) to preserve char
my (#strings) = split(/(?<=[;|])/, $string);
One way is to inject another character, like \n, whenever your special character is found, then split on the \n:
use warnings;
use strict;
use Data::Dumper;
while (<DATA>) {
chomp;
s/([;|])/$1\n/g;
my #string = split /\n/;
print Dumper(\#string);
}
__DATA__
Would you; please hand me| my coat?
Prints out:
$VAR1 = [
'Would you;',
' please hand me|',
' my coat?'
];
UPDATE: The original question posed by James showed the input text on a single line, as shown in __DATA__ above. Because the question was poorly formatted, others edited the question, breaking the 1 line into 2. Only James knows whether 1 or 2 lines was intended.
I prefer #toolic's answer because it deals with multiple separators very easily.
However, if you wanted to overly complicate things, you could always try:
#!/usr/bin/perl
use strict; use warnings;
my #contents = ('');
while ( my $line = <DATA> ) {
last unless $line =~ /\S/;
$line =~ s{$/}{ };
if ( $line =~ /^([^|;]+[|;])(.+)$/ ) {
$contents[-1] .= $1;
push #contents, $2;
}
else {
$contents[-1] .= $1;
}
}
print "[$_]\n" for #contents;
__DATA__
Would you; please
hand me| my coat?
Something along the lines of
$text = <INPUTFILE>;
#string = split(/[;!]/, $text);
should do the trick more or less.
Edit: I've changed "/;!/" to "/[;!]/".
Let Perl do half the work for you by setting $/ (the input record separator) to vertical bar, and then extract semicolon-separated fields:
#!/usr/bin/perl
use warnings;
use strict;
my #string;
*ARGV = *DATA;
$/ = "|";
while (<>) {
s/\n+$//;
s/\n/ /g;
push #string => $1 while s/^(.*;)//;
push #string => $_;
}
for (my $i = 0; $i < #string; ++$i) {
print "\$string[$i] = '$string[$i]';\n";
}
__DATA__
Would you; please
hand me| my coat?
Output:
$string[0] = 'Would you;';
$string[1] = ' please hand me|';
$string[2] = ' my coat?';