I am trying to implement shell commands in knitr and display the output in the knitted pdf document as shown here:
```{r shell commands, engine="sh"}
wc -wlmc en_US.blogs.txt
```
I am not sure whether this is even being evaluated, as there is no output.
just realized that I can call this with system(), which will print to device! Therefore,
system("wc -l en_US.blogs.txt")
will print to the display.
Use intern=TRUE to return result of system() as character vector, then cat with past and collapse. Example.
x <- system("tree", intern=TRUE)
cat(paste(x, collapse="\n"))
places tree of working directory in output document using knitr.
Related
How do I get the q script output to be displayed in QPad64's (QInsightPad's) output window. I am presently starting q and QPad 64 with the following .bat file :
set QHOME=C:\Q\q
set QINIT=C:\code\server.q
set PATH=%PATH%;%QHOME%;%QHOME%\w32
START C:\QInsightPad-2.2_FREE-x64\qpad64.exe
Result: q opens in cmd window, but all output from scipts run in Qpad show up there ( in cmd ) instead of in Qpad's output window. How do I fix this ?
Qpad isn't really designed to be used like that. You could redirect the stdout and read it in to view in qpad.
\1 qproc.log
Your scripts could then have output to the log as certain things are done like so:
1"tables_loaded"
// \n for new line
1"\nfuncs_loaded"
read0 `:qproc.log
"tables_loaded"
"funcs_loaded"
I am trying to identify misspelled words with Aspell via Perl. I am working on a Linux server without administrator privileges which means I have access to Perl and Aspell but not, for example, Text::Aspell which is a Perl interface for Aspell.
I want to do the very simple task of passing a list of words to Aspell and having it return the words that are misspelled. If the words I want to check are "dad word lkjlkjlkj" I can do this through the command line with the following commands:
aspell list
dad word lkjlkjlkj
Aspell requires CTRL + D at the end to submit the word list. It would then return "lkjlkjlkj", as this isn't in the dictionary.
In order to do the exact same thing, but submitted via Perl (because I need to do this for thousands of documents) I have tried:
my $list = q(dad word lkjlkjlkj):
my #arguments = ("aspell list", $list, "^D");
my $aspell_out=`#arguments`;
print "Aspell output = $aspell_out\n";
The expected output is "Aspell output = lkjlkjlkj" because this is the output that Aspell gives when you submit these commands via the command line. However, the actual output is just "Aspell output = ". That is, Perl does not capture any output from Aspell. No errors are thrown.
I am not an expert programmer, but I thought this would be a fairly simple task. I've tried various iterations of this code and nothing works. I did some digging and I'm concerned that perhaps because Aspell is interactive, I need to use something like Expect, but I cannot figure out how to use it. Nor am I sure that it is actually the solution to my problem. I also think ^D should be an appropriate replacement for CTRL+D at the end of the commands, but all I know is it doesn't throw an error. I also tried \cd instead. Whatever it is, there is obviously an issue in either submitting the command or capturing the output.
The complication with using aspell out of a program is that it is an interactive and command-line driver tool, as you suspect. However, there is a simple way to do what you need.
In order to use aspell's command list one needs to pass it words via STDIN, as its man page says. While I find the GNU Aspell manual a little difficult to get going with, passing input to a program via its STDIN is easy enough and we can rewrite the invocation as
echo dad word lkj | aspell list
We get lkj printed back, as due. Now this can run out of a program just as it stands
my $word_list = q(word lkj good asdf);
my $cmd = qq(echo $word_list | aspell list);
my #aspell_out = qx($cmd);
print for #aspell_out;
This prints lines lkj and asdf.
I assemble the command in a string (as opposed to an array) for specific reasons, explained below. The qx is the operator form of backticks, which I prefer for its far superior readability.
Note that qx can return all output in a string, if in scalar context (assigned to a scalar for example), or in a list when in list context. Here I assign to an array so you get each word as an element (alas, each also comes with a newline, so may want to do chomp #aspell_out;).
Comment on a list vs string form of a command
I think that it's safe to recommend to use a list-form for a command, in general. So we'd say
my #cmd = ('ls', '-l', $dir); # to be run as an external command
instead of
my $cmd = "ls -l $dir"; # to be run as an external command
The list form generally makes it easier to manage the command, and it avoids the shell altogether.
However, this case is a little different
The qx operator doesn't really behave differently -- the array gets concatenated into a string, and that runs. The very fact that we can pass it an array is incidental, and not even documented
We need to pipe input to aspell's STDIN, and shell does that for us simply. We can use a shell with command's LIST form as well, but then we'd need to invoke it explicitly. We can also go for aspell's STDIN by means other than the shell but that's more complex
With a command in a list the command name must be the first word, so that "aspell list" from the question is wrong and it should fail (there is no command named that) ... except that in this case it wouldn't (if the rest were correct), since for qx the array gets collapsed into a string
Finally, apsell nicely exposes its API in a C library and that's been utilized for the module you mention. I'd suggest to install it as a user (no privileges needed) and use that.
You should take a step back and investigate if you can install Text::Aspell without administrator privilige. In most cases that's perfectly possible.
You can install modules into your home directory. If there is no C-compiler available on the server you can install the module on a compatible machine, compile and copy the files.
-- Edit : Resolved. See answer.
Background:
I'm writing a shell that will perform some extra actions required on our system when someone resizes a database.
The shell is written in ksh (requirement), the OS is Solaris 5.10 .
The problem is with one of the checks, which verifies there's enough free space on the underlying OS.
Problem:
The check reads the df -k line for root, which is what I check in this step, and prints it to a file. I then "read" the contents into variables which I use in calculations.
Unfortunately, when I try to run an arithmetic operation on one of the variables, I get an error indicating it is null. And a debug output line I've placed after that line verifies that it is null... It lost it's value...
I've tried every method of doing this I could find online, they work when I run it manually, but not inside the shell file.
(* The file does have #!/usr/bin/ksh)
Code:
df -k | grep "rpool/ROOT" > dftest.out
RPOOL_NAME=""; declare -i TOTAL_SIZE=0; USED_SPACE=0; AVAILABLE_SPACE=0; AVAILABLE_PERCENT=0; RSIGN=""
read RPOOL_NAME TOTAL_SIZE USED_SPACE AVAILABLE_SPACE AVAILABLE_PERCENT RSIGN < dftest.out
\rm dftest.out
echo $RPOOL_NAME $TOTAL_SIZE $USED_SPACE $AVAILABLE_SPACE $AVAILABLE_PERCENT $RSIGN
((TOTAL_SIZE=$TOTAL_SIZE/1024))
This is the result:
DBResize.sh[11]: TOTAL_SIZE=/1024: syntax error
I'm pulling hairs at this point, any help would be appreciated.
The code you posted cannot produce the output you posted. Most obviously, the error is signalled at line 11 but you posted fewer than 11 lines of code. The previous lines may matter. Always post complete code when you ask for help.
More concretely, the declare command doesn't exist in ksh, it's a bash thing. You can achieve the same result with typeset (declare is a bash equivalent to typeset, but not all options are the same). Either you're executing this script with bash, or there's another error message about declare, or you've defined some additional commands including declare which may change the behavior of this code.
None of this should have an impact on the particular problem that you're posting about, however. The variables created by read remain assigned until the end of the subshell, i.e. until the code hits a ), the end of a pipe (left-hand side of the pipe only in ksh), etc.
About the use of declare or typeset, note that you're only declaring TOTAL_SIZE as an integer. For the other variables, you're just assigning a value which happens to consist exclusively of digits. It doesn't matter for the code you posted, but it's probably not what you meant.
One thing that may be happening is that grep matches nothing, and therefore read reads an empty line. You should check for errors. Use set -e in scripts to exit at the first error. (There are cases where set -e doesn't catch errors, but it's a good start.)
Another thing that may be happening is that df is splitting its output onto multiple lines because the first column containing the filesystem name is too large. To prevent this splitting, pass the option -P.
Using a temporary file is fragile: the code may be executed in a read-only directory, another process may want to access the same file at the same time... Here a temporary file is useless. Just pipe directly into read. In ksh (unlike most other sh variants including bash), the right-hand side of a pipe runs in the main shell, so assignments to variables in the right-hand side of a pipe remain available in the following commands.
It doesn't matter in this particular script, but you can use a variable without $ in an arithmetic expression. Using $ substitutes a string which can have confusing results, e.g. a='1+2'; $((a*3)) expands to 7. Not using $ uses the numerical value (in ksh, a='1+2'; $((a*3)) expands to 9; in some sh implementations you get an error because a's value is not numeric).
#!/usr/bin/ksh
set -e
typeset -i TOTAL_SIZE=0 USED_SPACE=0 AVAILABLE_SPACE=0 AVAILABLE_PERCENT=0
df -Pk | grep "rpool/ROOT" | read RPOOL_NAME TOTAL_SIZE USED_SPACE AVAILABLE_SPACE AVAILABLE_PERCENT RSIGN
echo $RPOOL_NAME $TOTAL_SIZE $USED_SPACE $AVAILABLE_SPACE $AVAILABLE_PERCENT $RSIGN
((TOTAL_SIZE=TOTAL_SIZE/1024))
Strange...when I get rid of your "declare" line, your original code seems to work perfectly well (at least with ksh on Linux)
The code :
#!/bin/ksh
df -k | grep "/home" > dftest.out
read RPOOL_NAME TOTAL_SIZE USED_SPACE AVAILABLE_SPACE AVAILABLE_PERCENT RSIGN < dftest.out
\rm dftest.out
echo $RPOOL_NAME $TOTAL_SIZE $USED_SPACE $AVAILABLE_SPACE $AVAILABLE_PERCENT $RSIGN
((TOTAL_SIZE=$TOTAL_SIZE/1024))
print $TOTAL_SIZE
The result :
32962416 5732492 25552588 19% /home
5598
Which are the value a simple df -k is returning. The variables seem to last.
For those interested, I have figured out that it is not possible to use "read" the way I was using it.
The variable values assigned by "read" simply "do not last".
To remedy this, I have applied the less than ideal solution of using the standard "while read" format, and inside the loop, echo selected variables into a variable file.
Once said file was created, I just "loaded" it.
(pseudo code:)
LOOP START
echo "VAR_A="$VAR_A"; VAR_B="$VAR_B";" > somefile.out
LOOP END
. somefile.out
I need to execute command from Perl script and print it's output, however command output is colored and Perl prints something like that:
ESC[33m sample text ESC[m
instead of coloring sample text.
In other words: I want to know how to handle already colored input in Perl (not how to create colored output)
I would start with the colorstrip function in Term::ANSIColor
uncolor
uncolor takes input from files or standard input and returns in with
colors and attributes stripped.
so I call an external program in perl and want to capture it's output:
my #RNAalifoldOut = `RNAalifold some parameters`;
If called from command line the output consists of three lines, e.g:
4 sequences; length of alignment 48.
__GCCGA_UGUAGCUCAGUUGGG_AGAGCGCCAGACUGAAAAUCAGA
...((((.....((((.........)))).(((((.......)))))
However my array #RNAalifoldOut contains only the two last lines and the first line appears directly on the screen when the line is being executed.
How can this be? I thought maybe the program writes the first line to STDERR, but isn't that discarded by the backticks operator? And what could I do to hide this output?
Regards
Nick
You are likely seeing the standard error from RNAalifold. Backticks capture only the standard output.
Capture both standard output and standard error by changing your code to
my #RNAalifoldOut = `RNAalifold some parameters 2>&1`;
To discard the standard error, use
my #RNAalifoldOut = `RNAalifold some parameters 2>/dev/null`;
on Unix-like platforms. On Windows, use
my #RNAalifoldOut = `RNAalifold some parameters 2>nul`;