perl manipulate with big files - perl

I'm working on a 16GB file and a small file.
I tried to load both files into memory. Then, I moved on each line in the big file and validate something in the small file (for each line in the big file I iterated on the small one).
This is my code
local $/ = undef;
open my $fh1, '<', $in or die "error opening $in: $!";
my $input_file = do { local $/; <$fh1> };
local $/ = undef;
open my $fh2, '<', $handle or die "error opening $handle: $!";
my $handle_file = do { local $/; <$fh2> };
my $counter_yes = 0;
my $counter_no = 0;
my $flag = 0;
my #lines1 = split /\n/, $input_file;
foreach my $line( #lines1 ) {
my #f = split('\t', $line); # $f[0] and $f[1]
print "f0 and f1 are: $f[0] and $f[1]\n";
my #lines2 = split /\n/, $handle_file;
foreach my $input ( #lines2 ){
#print "line2 is: $input\n";
my #sp = split /:/, $input; # $sp[0] and $sp[1]
if ( $sp[0] eq $f[0] ){
my #r = split /-/, $sp[1];
if ( ($f[1] >= $r[0]) && ($f[1] <= $r[1]) ){
$flag = 1;
$counter_yes = $counter_yes;
last;
}
}
}
if ( $flag == 0 ){
$counter_no = $counter_no ;
}
}
While I running it I get the error
Split loop at script.pl line 30, <$fh2> chunk 1
What can be the reason?

You can run perldoc perldiag to learn what some built in errors and warnings mean.
Split loop
(P) The split was looping infinitely. (Obviously, a split
shouldn't iterate more times than there are characters of input,
which is what happened.) See "split" in perlfunc.
The string you're splitting on is so large, Perl thought it was iterating infinitely. When Perl has split a string more times than the length of the string + 10, it gives this error assuming its in an infinite loop. Unfortunately for you, it stored that number as a 32 bit integer which can only hold up to 2 billion and change. Your string is over 16 billion so the result will be unpredictable.
This was recently fixed in 5.20 along with many other related problems with working with strings over 2G in size. So if you upgrade Perl your code will "work".
However, your code is hideously inefficient and will crush the memory of most machines causing it to slow down terribly as it swaps to disk. At minimum you should only slurp in the small file and read the 16 gig file line by line.
my #small_data = <$small_fh>;
chomp #small_data;
while( my $big = <$big_fh> ) {
chomp $big;
for my $small (#small_data) {
...
}
}
But even that is going to be terribly inefficient, if your small file contains 1000 lines then that loop will run 16 trillion times!
Since it seems like you're checking to see if entries in the big file are in the small file, you're better off turning the entries in the small file into a hash table.
my %fields;
while( my $line = <$small_fh> ) {
chomp $line;
my #sp = split /:/, $line;
$fields{$sp[0]} = $sp[1];
}
Now you can iterate through the big file and just do a hash lookup.
while( my $line = <$big_fh> ) {
chomp $line;
my #f = split('\t', $line);
if( defined $fields{$f[0]} ) {
...
}
}

Why are you reading the whole file into one big string and splitting it into an array of lines, when you could be reading it into an array of lines to begin with? And why do you do it over and over again for the second file? You can just
chomp(my #lines1 = <$fh>);
chomp(my #lines2 = <$fh2>);
at the top of your program and eliminate $input_file and $handle_file which are otherwise unused, and all of the $/ nonsense. This could very well be the source of the problem, since the error message indicates that split is producing "too many" fields.

I'm working on a 16GB file and a small file.
I tried to load both files into memory.
Do you have 16GB of memory? Actually, your code requires more than 32GB of memory.
Split loop at script.pl line 30, chunk 1
I can't duplicate that error. Perl errors are usually pretty descriptive, yet that isn't even comprehensible.
Next, if you had this in your code:
my $x = 10;
#nothing changes $x
#in these
#lines
$x = 10;
What would be the purpose of the last line? Yet, you did this:
$/ = undef;
#Nothing changes $/
#in these lines
$/ = undef;
Next, all perl programs should start with the following lines:
<guess>
If you don't know, then you need to buy a beginning perl book.

Related

Perl File Writing and Reading using Hashes or Associative Arrays

So I am working on this homework assignment and we have to read a text file of menu items in this case the text file reads -
Hamburgers - 1.79
Cheeseburgers - 2.00
Fries - 1.50
I need to be able to print out the text in the file and then take input to change the prices while putting them in an associative array or hash. I am honestly pretty suck at the moment here is what I have. I know about > means to write the file but I was not sure if it should be used since I want to view the original files first.
#!/usr/bin/perl
open(FH, "gp1data.txt") || die("Cannot open the file.");
print "$_";
while (<FH>){
print "$_";
}
my %menu;
while (my $line2 = <$prices>) {
chomp $line2;
my #row = split(/-/, $line2);
$menu{$row[0]} = $row[1];
}
<>;
What I am thinking is that the file gets opened and then prints whats in the file then I should be able to take what is printed and put it through the while loop while making it into a hash.
I wrote an associative array that contains what is in the text file to try using it in my code I have had no luck so far. here is the array I wrote.
%x = ("Hamburger" => 1.50, => "Cheeseburger" 2.00, "Fries" => 1.79);
$x[0] = "Hamburger 1.50";
$x[1] = "Cheeseburger 2.00";
$x[2] = "Fries 1.79";
for ($i=0; $i<3; $i++)
{
$x[$i] =~ /-/;
$before = $`;
$after = $';
$x{$before} = $after;
}
foreach $item (keys %x)
{
print "A $item costs \$$x{$item}\n"
}
<>;
What this does is it prints what comes before the "-" and after "-" so you can see what is being sold and how much. Below is the exact problem word for word I was given.
"write a Perl program that will allow the user to read some data from a file, and then give the user the option of modifying the price of an item, and then store the information back to a file that can be read again later. "
Ok, I don't want to be mean. I remember the days I learned perl and saw a co-worker's script. He said "It took me 1/2 an hour to write that single line, so it's ok if it takes you 1/2 an hour to read it.".
Perl can be quite hard to read, so I kept the code simple.
Suppose this is your input file, say menu.txt:
Hamburgers - 1.79
Cheeseburgers - 2.00
Fries - 1.50
You can read it like this:
use strict;
use warnings;
my %menu;
open(my $input, "<menu.txt" ) || or die "cannot open menu.txt: $!\n";
while( my $line = <$input> ) {
chomp($line);
my ($item, $price) = split( / - /, $line );
$menu{$item} = $price;
}
close($input);
Now you have the hash %menu filled with the menu,
i.e. $menu{'Hamburgers'} is 1.79 and so on.
How to change these values is left as an excercise. ;-)
After you have changed the values you can write them back to the (same or another) file:
open(my $output, ">new-menu.txt" ) || or die "cannot open new-menu.txt: $!\n";
foreach my $item ( keys %menu ) {
print $output "$item - $menu{$item}\n";
}
close($output);

Reading the next line in the file and keeping counts separate

Another question for everyone. To reiterate I am very new to the Perl process and I apologize in advance for making silly mistakes
I am trying to calculate the GC content of different lengths of DNA sequence. The file is in this format:
>gene 1
DNA sequence of specific gene
>gene 2
DNA sequence of specific gene
...etc...
This is a small piece of the file
>env
ATGCTTCTCATCTCAAACCCGCGCCACCTGGGGCACCCGATGAGTCCTGGGAA
I have established the counter and to read each line of DNA sequence but at the moment it is do a running summation of the total across all lines. I want it to read each sequence, print the content after the sequence read then move onto the next one. Having individual base counts for each line.
This is what I have so far.
#!/usr/bin/perl
#necessary code to open and read a new file and create a new one.
use strict;
my $infile = "Lab1_seq.fasta";
open INFILE, $infile or die "$infile: $!";
my $outfile = "Lab1_seq_output.txt";
open OUTFILE, ">$outfile" or die "Cannot open $outfile: $!";
#establishing the intial counts for each base
my $G = 0;
my $C = 0;
my $A = 0;
my $T = 0;
#initial loop created to read through each line
while ( my $line = <INFILE> ) {
chomp $line;
# reads file until the ">" character is encounterd and prints the line
if ($line =~ /^>/){
print OUTFILE "Gene: $line\n";
}
# otherwise count the content of the next line.
# my percent counts seem to be incorrect due to my Total length counts skewing the following line. I am currently unsure how to fix that
elsif ($line =~ /^[A-Z]/){
my #array = split //, $line;
my $array= (#array);
# reset the counts of each variable
$G = ();
$C = ();
$A = ();
$T = ();
foreach $array (#array){
#if statements asses which base is present and makes a running total of the bases.
if ($array eq 'G'){
++$G;
}
elsif ( $array eq 'C' ) {
++$C; }
elsif ( $array eq 'A' ) {
++$A; }
elsif ( $array eq 'T' ) {
++$T; }
}
# all is printed to the outfile
print OUTFILE "G:$G\n";
print OUTFILE "C:$C\n";
print OUTFILE "A:$A\n";
print OUTFILE "T:$T\n";
print OUTFILE "Total length:_", ($A+=$C+=$G+=$T), "_base pairs\n";
print OUTFILE "GC content is(percent):_", (($G+=$C)/($A+=$C+=$G+=$T)*100),"_%\n";
}
}
#close the outfile and the infile
close OUTFILE;
close INFILE;
Again I feel like I am on the right path, I am just missing some basic foundations. Any help would be greatly appreciated.
The final problem is in the final counts printed out. My percent values are wrong and give me the wrong value. I feel like the total is being calculated then that new value is incorporated into the total.
Several things:
1. use hash instead of declaring each element.
2. assignment such as $G = (0); is indeed working, but it is not the right way to assign scalar. What you did is declaring an array, which in scalar context $G = is returning the first array item. The correct way is $G = 0.
my %seen;
$seen{/^([A-Z])/}++ for (grep {/^\>/} <INFILE>);
foreach $gene (keys %seen) {
print "$gene: $seen{$gene}\n";
}
Just reset the counters when a new gene is found. Also, I'd use hashes for the counting:
use strict; use warnings;
my %counts;
while (<>) {
if (/^>/) {
# print counts for the prev gene if there are counts:
print_counts(\%counts) if keys %counts;
%counts = (); # reset the counts
print $_; # print the Fasta header
} else {
chomp;
$counts{$_}++ for split //;
}
}
print_counts(\%counts) if keys %counts; # print counts for last gene
sub print_counts {
my ($counts) = #_;
print "$_:=", ($counts->{$_} || 0), "\n" for qw/A C G T/;
}
Usage: $ perl count-bases.pl input.fasta.
Example output:
> gene 1
A:=3
C:=1
G:=5
T:=5
> gene 2
A:=1
C:=5
G:=0
T:=13
Style comments:
When opening a file, always use lexical filehandles (normal variables). Also, you should do a three-arg open. I'd also recommend the autodie pragma for automatic error handling (since perl v5.10.1).
use autodie;
open my $in, "<", $infile;
open my $out, ">", $outfile;
Note that I don't open files in my above script because I use the special ARGV filehandle for input, and print to STDOUT. The output can be redirected on the shell, like
$ perl count-bases.pl input.fasta >counts.txt
Declaring scalar variables with their values in parens like my $G = (0) is weird, but works fine. I think this is more confusing than helpful. → my $G = 0.
Your intendation is a bit weird. It is very unusual and visually confusing to put closing braces on the same line with another statement like
...
elsif ( $array eq 'C' ) {
++$C; }
I prefer cuddling elsif:
...
} elsif ($base eq 'C') {
$C++;
}
This statement my $array= (#array); puts the length of the array into $array. What for? Tip: You can declare variables right inside foreach-loops, like for my $base (#array) { ... }.

Printing array in Perl

I currently have my Perl script to read fstab files, split them up by column and search for which word in each column is the longest to display it. All that works peachy (I think), the problem I'm having is that it keeps printing out the same length for every line which is not true. Example $dev_parts prints 24, and $labe_parts prints 24 and so on...
below is my code.
#!/usr/bin/perl
use strict;
print "Enter file name: \n";
my $file_name = <STDIN>;
open(IN, "$file_name");
my #parts = split( /\s+/, $file_name);
foreach my $usr_file (<IN>) {
chomp($usr_file);
#parts = split( /\s+/, $usr_file);
push(#dev, $parts[0]);
push(#label, $parts[1]);
push(#tmpfs, $parts[2]);
push(#devpts, $parts[3]);
push(#sysfs, $parts[4]);
push(#proc, $parts[5]);
}
foreach $dev_parts (#dev) {
$dev_length1 = length ($parts[$dev_parts]);
if ( $dev_length1 > $dev_length2) {
$dev_length2 = $dev_length1;
}
}
print "The longest word in the first line is: $dev_length2 \n";
foreach $label_parts (#label) {
$label_length1 = length($parts[$label_parts]);
if ($label_length1 > $label_length2) {
$label_length2 = $label_length1;
}
}
print "The longest word in the first line is: $label_length2 \n";
This is how your code should be
#!/usr/bin/perl
use strict;
use warnings;
use Data::Dumper;
print "Enter file name: \n";
my $file_name = <STDIN>;
chomp($file_name);
open(FILE, "$file_name") or die $!;
my %colhash;
while (<FILE>) {
my $col=0;
my #parts = split /\s+/;
map { my $len = length($_);
$col++;
if($colhash{$col} < $len ){
$colhash{$col} = $len; # store the longest word length for each column
}
} #parts;
}
print Dumper(\%colhash);
You have a mistake here:
foreach $dev_parts (#dev) {
$dev_length1 = length ($parts[$dev_parts]);
As I understand it, you are looking for the longest element in #dev. However, you take the length of an element from the #parts array. This array is always set to whatever the last line of the file is. So you are looking at each element in the last line of the file, rather than each element of the appropriate column.
You just need to take length($dev_parts) instead.
Incidentally, here is a simpler way to find the longest length in an array:
use List::Util qw/max/; #Core module, always available.
my $longest_dev = max map {length} #dev;
A few other comments on your code:
use strict; is good. You should also use warnings;. It will help
you catch silly mistakes in your code.
You ought to check for errors whenever you open a file:
open(IN, $file_name) or die "Failed to open $file_name: $!";
Better yet, use the preferred open syntax with a lexical filehandle:
open(my $in_file, '<', $file_name) or die "Failed to open $file_name: $!";
...
while (<$in_file>) {
I'm not sure what you are trying to do here:
my #parts = split( /\s+/, $file_name);
You are splitting the file name by white space, but you don't use that for anything. And then you re-use the same array to hold the lines later.
A while loop is preferred to foreach when you go through lines of a file. It saves memory because it doesn't read the whole file into memory first (and it is otherwise exactly the same).
while (my $usr_file = <IN>) {

Using Perl hashes to handle tab-delimited files

I have two files:
file_1 has three columns (Marker(SNP), Chromosome, and position)
file_2 has three columns (Chromosome, peak_start, and peak_end).
All columns are numeric except for the SNP column.
The files are arranged as shown in the screenshots. file_1 has several hundred SNPs as rows while file_2 has 61 peaks. Each peak is marked by a peak_start and peak_end. There can be any of the 23 chromosomes in either file and file_2 has several peaks per chromosome.
I want to find if the position of the SNP in file_1 falls within the peak_start and peak_end in file_2 for each matching chromosome. If it does, I want to show which SNP falls in which peak (preferably write output to a tab-delimited file).
I would prefer to split the file, and use hashes where the chromosome is the key. I have found only a few questions remotely similar to this, but I could not understand well the suggested solutions.
Here is the example of my code. It is only meant to illustrate my question and so far doesn't do anything so think of it as "pseudocode".
#!usr/bin/perl
use strict;
use warnings;
my (%peaks, %X81_05);
my #array;
# Open file or die
unless (open (FIRST_SAMPLE, "X81_05.txt")) {
die "Could not open X81_05.txt";
}
# Split the tab-delimited file into respective fields
while (<FIRST_SAMPLE>) {
chomp $_;
next if (m/Chromosome/); # Skip the header
#array = split("\t", $_);
($chr1, $pos, $sample) = #array;
$X81_05{'$array[0]'} = (
'position' =>'$array[1]'
)
}
close (FIRST_SAMPLE);
# Open file using file handle
unless (open (PEAKS, "peaks.txt")) {
die "could not open peaks.txt";
}
my ($chr, $peak_start, $peak_end);
while (<PEAKS>) {
chomp $_;
next if (m/Chromosome/); # Skip header
($chr, $peak_start, $peak_end) = split(/\t/);
$peaks{$chr}{'peak_start'} = $peak_start;
$peaks{$chr}{'peak_end'} = $peak_end;
}
close (PEAKS);
for my $chr1 (keys %X81_05) {
my $val = $X81_05{$chr1}{'position'};
for my $chr (keys %peaks) {
my $min = $peaks{$chr}{'peak_start'};
my $max = $peaks{$chr}{'peak_end'};
if (($val > $min) and ($val < $max)) {
#print $val, " ", "lies between"," ", $min, " ", "and", " ", $max, "\n";
}
else {
#print $val, " ", "does not lie between"," ", $min, " ", "and", " ", $max, "\n";
}
}
}
More awesome code:
http://i.stack.imgur.com/fzwRQ.png
http://i.stack.imgur.com/2ryyI.png
A couple of program hints in Perl:
You can do this:
open (PEAKS, "peaks.txt")
or die "Couldn't open peaks.txt";
Instead of this:
unless (open (PEAKS, "peaks.txt")) {
die "could not open peaks.txt";
}
It's more standard Perl, and it's a bit easier to read.
Talking about Standard Perl, you should use the 3 argument open form, and use scalars for file handles:
open (my $peaks_fh, "<", "peaks.txt")
or die "Couldn't open peaks.txt";
This way, if your file's name just happens to start with a | or >, it will still work. Using scalars variables (variables that start with a $) makes it easier to pass file handles between functions.
Anyway, just to make sure I understand you correctly: You said "I would prefer ... use hashes where the chromosome is the key."
Now, I have 23 pairs of chromosomes, but each of those chromosomes might have thousands of SNPs on it. If you key by chromosome this way, you can only store a single SNP per chromosome. Is this what you want? I notice your data is showing all the same chromosome. That means you can't key by chromosome. I'm ignoring that for now, and using my own data.
I've also noticed a difference in what you said the files contained, and how your program uses them:
You said: "file 1 has 3 columns (SNP, Chromosome, and position)" , yet your code is:
($chr1, $pos, $sample) = #array;
Which I assume is Chromosome, Position, and SNP. Which way is the file arranged?
You've got to clarify exactly what you're asking for.
Anyway, here's the tested version that prints out in tab delimited format. This is in a bit more modern Perl format. Notice that I only have a single hash by chromosome (as you specified). I read the peaks.txt in first. If I find in my position file a chromosome that doesn't exist in my peaks.txt file, I simply ignore it. Otherwise, I'll add in the additional hashes for POSITION and SNP:
I do a final loop that prints everything out (tab delimitated) as you specified, but you didn't specify a format. Change it if you have to.
#! /usr/bin/env perl
use strict;
use warnings;
use feature qw(say);
use autodie; #No need to check for file open failure
use constant {
PEAKS_FILE => "peak.txt",
POSITION_FILE => "X81_05.txt",
};
open ( my $peak_fh, "<", PEAKS_FILE );
my %chromosome_hash;
while ( my $line = <$peak_fh> ) {
chomp $line;
next if $line =~ /Chromosome/; #Skip Header
my ( $chromosome, $peak_start, $peak_end ) = split ( "\t", $line );
$chromosome_hash{$chromosome}->{PEAK_START} = $peak_start;
$chromosome_hash{$chromosome}->{PEAK_END} = $peak_end;
}
close $peak_fh;
open ( my $position_fh, "<", POSITION_FILE );
while ( my $line = <$position_fh> ) {
chomp $line;
my ( $chromosome, $position, $snp ) = split ( "\t", $line );
next unless exists $chromosome_hash{$chromosome};
if ( $position >= $chromosome_hash{$chromosome}->{PEAK_START}
and $position <= $chromosome_hash{$chromosome}->{PEAK_END} ) {
$chromosome_hash{$chromosome}->{SNP} = $snp;
$chromosome_hash{$chromosome}->{POSITION} = $position;
}
}
close $position_fh;
#
# Now Print
#
say join ("\t", qw(Chromosome, SNP, POSITION, PEAK-START, PEAK-END) );
foreach my $chromosome ( sort keys %chromosome_hash ) {
next unless exists $chromosome_hash{$chromosome}->{SNP};
say join ("\t",
$chromosome,
$chromosome_hash{$chromosome}->{SNP},
$chromosome_hash{$chromosome}->{POSITION},
$chromosome_hash{$chromosome}->{PEAK_START},
$chromosome_hash{$chromosome}->{PEAK_END},
);
}
A few things:
Leave spaces around parentheses on both sides. It makes it easier to read.
I use parentheses when others don't. The current style is not to use them unless you have to. I tend to use them for all functions that take more than a single argument. For example, I could have said open my $peak_fh, "<", PEAKS_FILE;, but I think parameters start to get lost when you have three parameters on a function.
Notice I use use autodie;. This causes the program to quit if it can't open a file. That's why I don't even have to test whether or not the file opened.
I would have preferred to use object oriented Perl to hide the structure of the hash of hashes. This prevents errors such as thinking that the start peek is stored in START_PEEK rather than PEAK_START. Perl won't detect these type of miskeyed errors. Therefore, I prefer to use objects whenever I am doing arrays of arrays or hashes of hashes.
You only need one for loop because you are expecting to find some of the SNPs in the second lot. Hence, loop through your %X81_05 hash and check if any matches one in %peak. Something like:
for my $chr1 (keys %X81_05)
{
if (defined $peaks{$chr1})
{
if ( $X81_05{$chr1}{'position'} > $peaks{$chr1}{'peak_start'}
&& $X81_05{$chr1}{'position'} < $peaks{$chr1}{'peak_end'})
{
print YOUROUTPUTFILEHANDLE $chr1 . "\t"
. $peaks{$chr1}{'peak_start'} . "\t"
. $peaks{$chr1}{'peak_end'};
}
else
{
print YOUROUTPUTFILEHANDLE $chr1
. "\tDoes not fall between "
. $peaks{$chr1}{'peak_start'} . " and "
. $peaks{$chr1}{'peak_end'};
}
}
}
Note: I Have not tested the code.
Looking at the screenshots that you have added, this is not going to work.
The points raised by #David are good; try to incorporate those in your programs. (I have borrowed most of the code from #David's post.)
One thing I didn't understand is that why load both peak values and position in hash, as loading one would suffice. As each chromosome has more than one record, use HoA. My solution is based on that. You might need to change the cols and their positions.
use strict;
use warnings;
our $Sep = "\t";
open (my $peak_fh, "<", "data/file2");
my %chromosome_hash;
while (my $line = <$peak_fh>) {
chomp $line;
next if $line =~ /Chromosome/; #Skip Header
my ($chromosome) = (split($Sep, $line))[0];
push #{$chromosome_hash{$chromosome}}, $line; # Store the line(s) indexed by chromo
}
close $peak_fh;
open (my $position_fh, "<", "data/file1");
while (my $line = <$position_fh>) {
chomp $line;
my ($chromosome, $snp, $position) = split ($Sep, $line);
next unless exists $chromosome_hash{$chromosome};
foreach my $peak_line (#{$chromosome_hash{$chromosome}}) {
my ($start,$end) = (split($Sep, $line))[1,2];
if ($position >= $start and $position <= $end) {
print "MATCH REQUIRED-DETAILS...$line-$peak_line\n";
}
else {
print "NO MATCH REQUIRED-DETAILS...$line-$peak_line\n";
}
}
}
close $position_fh;
I used #tuxuday and #David's code to solve this problem. Here is the final code that did what I wanted. I have not only learned a lot, but I have been able to solve my problem successfully! Kudos guys!
use strict;
use warnings;
use feature qw(say);
# Read in peaks and sample files from command line
my $usage = "Usage: $0 <peaks_file> <sample_file>";
my $peaks = shift #ARGV or die "$usage \n";
my $sample = shift #ARGV or die "$usage \n";
our $Sep = "\t";
open (my $peak_fh, "<", "$peaks");
my %chromosome_hash;
while (my $line = <$peak_fh>) {
chomp $line;
next if $line =~ /Chromosome/; #Skip Header
my ($chromosome) = (split($Sep, $line))[0];
push #{$chromosome_hash{$chromosome}}, $line; # Store the line(s) indexed by chromosome
}
close $peak_fh;
open (my $position_fh, "<", "$sample");
while (my $line = <$position_fh>) {
chomp $line;
next if $line =~ /Marker/; #Skip Header
my ($snp, $chromosome, $position) = split ($Sep, $line);
# Check if chromosome in peaks_file matches chromosome in sample_file
next unless exists $chromosome_hash{$chromosome};
foreach my $peak_line (#{$chromosome_hash{$chromosome}}) {
my ($start,$end,$peak_no) = (split( $Sep, $peak_line ))[1,2,3];
if ( $position >= $start and $position <= $end) {
# Print output
say join ("\t",
$snp,
$chromosome,
$position,
$start,
$end,
$peak_no,
);
}
else {
next; # Go to next chromosome
}
}
}
close $position_fh;

Perl merging 2 csv files line by line with a primary key

Edit: solution added.
Hi, I currently have some working albeit slow code.
It merges 2 CSV files line by line using a primary key.
For example, if file 1 has the line:
"one,two,,four,42"
and file 2 has this line;
"one,,three,,42"
where in 0 indexed $position = 4 has the primary key = 42;
then the sub: merge_file($file1,$file2,$outputfile,$position);
will output a file with the line:
"one,two,three,four,42";
Every primary key is unique in each file, and a key might exist in one file but not in the other (and vice versa)
There are about 1 million lines in each file.
Going through every line in the first file, I am using a hash to store the primary key, and storing the line number as the value. The line number corresponds to an array[line num] which stores every line in the first file.
Then I go through every line in the second file, and check if the primary key is in the hash, and if it is, get the line from the file1array and then add the columns I need from the first array to the second array, and then concat. to the end. Then delete the hash, and then at the very end, dump the entire thing to file. (I am using a SSD so I want to minimise file writes.)
It is probably best explained with a code:
sub merge_file2{
my ($file1,$file2,$out,$position) = ($_[0],$_[1],$_[2],$_[3]);
print "merging: \n$file1 and \n$file2, to: \n$out\n";
my $OUTSTRING = undef;
my %line_for;
my #file1array;
open FILE1, "<$file1";
print "$file1 opened\n";
while (<FILE1>){
chomp;
$line_for{read_csv_string($_,$position)}=$.; #reads csv line at current position (of key)
$file1array[$.] = $_; #store line in file1array.
}
close FILE1;
print "$file2 opened - merging..\n";
open FILE2, "<", $file2;
my #from1to2 = qw( 2 4 8 17 18 19); #which columns from file 1 to be added into cols. of file 2.
while (<FILE2>){
print "$.\n" if ($.%1000) == 0;
chomp;
my #array1 = ();
my #array2 = ();
my #array2 = split /,/, $_; #split 2nd csv line by commas
my #array1 = split /,/, $file1array[$line_for{$array2[$position]}];
# ^ ^ ^
# prev line lookup line in 1st file,lookup hash, pos of key
#my #output = &merge_string(\#array1,\#array2); #merge 2 csv strings (old fn.)
foreach(#from1to2){
$array2[$_] = $array1[$_];
}
my $outstring = join ",", #array2;
$OUTSTRING.=$outstring."\n";
delete $line_for{$array2[$position]};
}
close FILE2;
print "adding rest of lines\n";
foreach my $key (sort { $a <=> $b } keys %line_for){
$OUTSTRING.= $file1array[$line_for{$key}]."\n";
}
print "writing file $out\n\n\n";
write_line($out,$OUTSTRING);
}
The first while is fine, takes less than 1 minute, however the second while loop takes about 1 hour to run, and I am wondering if I have taken the right approach. I think it is possible for a lot of speedup? :) Thanks in advance.
Solution:
sub merge_file3{
my ($file1,$file2,$out,$position,$hsize) = ($_[0],$_[1],$_[2],$_[3],$_[4]);
print "merging: \n$file1 and \n$file2, to: \n$out\n";
my $OUTSTRING = undef;
my $header;
my (#file1,#file2);
open FILE1, "<$file1" or die;
while (<FILE1>){
if ($.==1){
$header = $_;
next;
}
print "$.\n" if ($.%100000) == 0;
chomp;
push #file1, [split ',', $_];
}
close FILE1;
open FILE2, "<$file2" or die;
while (<FILE2>){
next if $.==1;
print "$.\n" if ($.%100000) == 0;
chomp;
push #file2, [split ',', $_];
}
close FILE2;
print "sorting files\n";
my #sortedf1 = sort {$a->[$position] <=> $b->[$position]} #file1;
my #sortedf2 = sort {$a->[$position] <=> $b->[$position]} #file2;
print "sorted\n";
#file1 = undef;
#file2 = undef;
#foreach my $line (#file1){print "\t [ #$line ],\n"; }
my ($i,$j) = (0,0);
while ($i < $#sortedf1 and $j < $#sortedf2){
my $key1 = $sortedf1[$i][$position];
my $key2 = $sortedf2[$j][$position];
if ($key1 eq $key2){
foreach(0..$hsize){ #header size.
$sortedf2[$j][$_] = $sortedf1[$i][$_] if $sortedf1[$i][$_] ne undef;
}
$i++;
$j++;
}
elsif ( $key1 < $key2){
push(#sortedf2,[#{$sortedf1[$i]}]);
$i++;
}
elsif ( $key1 > $key2){
$j++;
}
}
#foreach my $line (#sortedf2){print "\t [ #$line ],\n"; }
print "outputting to file\n";
open OUT, ">$out";
print OUT $header;
foreach(#sortedf2){
print OUT (join ",", #{$_})."\n";
}
close OUT;
}
Thanks everyone, the solution is posted above. It now takes about 1 minute to merge the whole thing! :)
Two techniques come to mind.
Read the data from the CSV files into two tables in a DBMS (SQLite would work just fine), and then use the DB to do a join and write the data back out to CSV. The database will use indexes to optimize the join.
First, sort each file by primary key (using perl or unix sort), then do a linear scan over each file in parallel (read a record from each file; if the keys are equal then output a joined row and advance both files; if the keys are unequal then advance the file with the lesser key and try again). This step is O(n + m) time instead of O(n * m), and O(1) memory.
What's killing the performance is this code, which is concatenating millions of times.
$OUTSTRING.=$outstring."\n";
....
foreach my $key (sort { $a <=> $b } keys %line_for){
$OUTSTRING.= $file1array[$line_for{$key}]."\n";
}
If you want to write to the output file only once, accumulate your results in an array, and then print them at the very end, using join. Or, even better perhaps, include the newlines in the results and write the array directly.
To see how concatenation does not scale when crunching big data, experiment with this demo script. When you run it in concat mode, things start slowing down considerably after a couple hundred thousand concatenations -- I gave up and killed the script. By contrast, simply printing an array of a million lines took less than a than a minute on my machine.
# Usage: perl demo.pl 50 999999 concat|join|direct
use strict;
use warnings;
my ($line_len, $n_lines, $method) = #ARGV;
my #data = map { '_' x $line_len . "\n" } 1 .. $n_lines;
open my $fh, '>', 'output.txt' or die $!;
if ($method eq 'concat'){ # Dog slow. Gets slower as #data gets big.
my $outstring;
for my $i (0 .. $#data){
print STDERR $i, "\n" if $i % 1000 == 0;
$outstring .= $data[$i];
}
print $fh $outstring;
}
elsif ($method eq 'join'){ # Fast
print $fh join('', #data);
}
else { # Fast
print $fh #data;
}
If you want merge you should really merge. First of all you have to sort your data by key and than merge! You will beat even MySQL in performance. I have a lot of experience with it.
You can write something along those lines:
#!/usr/bin/env perl
use strict;
use warnings;
use Text::CSV_XS;
use autodie;
use constant KEYPOS => 4;
die "Insufficient number of parameters" if #ARGV < 2;
my $csv = Text::CSV_XS->new( { eol => $/ } );
my $sortpos = KEYPOS + 1;
open my $file1, "sort -n -k$sortpos -t, $ARGV[0] |";
open my $file2, "sort -n -k$sortpos -t, $ARGV[1] |";
my $row1 = $csv->getline($file1);
my $row2 = $csv->getline($file2);
while ( $row1 and $row2 ) {
my $row;
if ( $row1->[KEYPOS] == $row2->[KEYPOS] ) { # merge rows
$row = [ map { $row1->[$_] || $row2->[$_] } 0 .. $#$row1 ];
$row1 = $csv->getline($file1);
$row2 = $csv->getline($file2);
}
elsif ( $row1->[KEYPOS] < $row2->[KEYPOS] ) {
$row = $row1;
$row1 = $csv->getline($file1);
}
else {
$row = $row2;
$row2 = $csv->getline($file2);
}
$csv->print( *STDOUT, $row );
}
# flush possible tail
while ( $row1 ) {
$csv->print( *STDOUT, $row1 );
$row1 = $csv->getline($file1);
}
while ( $row2 ) {
$csv->print( *STDOUT, $row2 );
$row2 = $csv->getline($file1);
}
close $file1;
close $file2;
Redirect output to file and measure.
If you like more sanity around sort arguments you can replace file opening part with
(open my $file1, '-|') || exec('sort', '-n', "-k$sortpos", '-t,', $ARGV[0]);
(open my $file2, '-|') || exec('sort', '-n', "-k$sortpos", '-t,', $ARGV[1]);
I can't see anything that strikes me as obviously slow, but I would make these changes:
First, I'd eliminate the #file1array variable. You don't need it; just store the line itself in the hash:
while (<FILE1>){
chomp;
$line_for{read_csv_string($_,$position)}=$_;
}
Secondly, although this shouldn't really make much of a difference with perl, I wouldn't add to $OUTSTRING all the time. Instead, keep an array of output lines and push onto it each time. If for some reason you still need to call write_line with a massive string you can always use join('', #OUTLINES) at the end.
If write_line doesn't use syswrite or something low-level like that, but rather uses print or other stdio-based calls, then you aren't saving any disk writes by building up the output file in memory. Therefore, you might as well not build your output up in memory at all, and instead just write it out as you create it. Of course if you are using syswrite, forget this.
Since nothing is obviously slow, try throwing Devel::SmallProf at your code. I've found that to be the best perl profiler for producing those "Oh! That's the slow line!" insights.
Assuming around 20 bytes lines each of your file would amount to about 20 MB, which isn't too big.
Since you are using hash your time complexity doesn't seem to be a problem.
In your second loop, you are printing to the console for each line, this bit is slow. Try removing that should help a lot.
You can also avoid the delete in the second loop.
Reading multiple lines at a time should also help. But not too much I think, there is always going to be a read ahead behind the scenes.
I'd store each record in a hash whose keys are the primary keys. A given primary key's value is a reference to an array of CSV values, where undef represents an unknown value.
use 5.10.0; # for // ("defined-or")
use Carp;
use Text::CSV;
sub merge_csv {
my($path,$record) = #_;
open my $fh, "<", $path or croak "$0: open $path: $!";
my $csv = Text::CSV->new;
local $_;
while (<$fh>) {
if ($csv->parse($_)) {
my #f = map length($_) ? $_ : undef, $csv->fields;
next unless #f >= 1;
my $primary = pop #f;
if ($record->{$primary}) {
$record->{$primary}[$_] //= $f[$_]
for 0 .. $#{ $record->{$primary} };
}
else {
$record->{$primary} = \#f;
}
}
else {
warn "$0: $path:$.: parse failed; skipping...\n";
next;
}
}
}
Your main program will resemble
my %rec;
merge_csv $_, \%rec for qw/ file1 file2 /;
The Data::Dumper module shows that the resulting hash given the simple inputs from your question is
$VAR1 = {
'42' => [
'one',
'two',
'three',
'four'
]
};