Its a kind of bioinformatics concept but programmatic problem. I've tried a lot and at last I came here. I've reads like following.
ATGGAAG
TGGAAGT
GGAAGTC
GAAGTCG
AAGTCGC
AGTCGCG
GTCGCGG
TCGCGGA
CGCGGAA
GCGGAAT
CGGAATC
Now what I want to do is, in a simplistic way,
take the last 6 residues of first read -> check if any other read is starting with those 6 residues, if yes add the last residue of that read to the first read -> again same with the 2nd read and so on.
Here is the code what I've tried so far.
#!/usr/bin/perl -w
use strict;
use warnings;
my $in = $ARGV[0];
open(IN, $in);
my #short_reads = <IN>;
my $first_read = $short_reads[0];
chomp $first_read;
my #all_end_res;
for(my $i=0; $i<=$#short_reads; $i++){
chomp $short_reads[$i];
my $end_of_kmers = substr($short_reads[$i], -6);
if($short_reads[$i+1] =~ /^$end_of_kmers/){
my $end_res = substr($short_reads[$i], -1);
push(#all_end_res, $end_res);
}
}
my $end_res2 = join('', #all_end_res);
print $first_read.$end_res2,"\n\n";
At the end I should get an output like ATGGAAGTCGCGGAATC but I'm getting ATGGAAGGTCGCGGAAT. The error must be in if, any help is greatly appreciated.
There are three huge problems in IT.
Naming of things.
Off by one error.
And you just hit the second one. The problem is in a way you think about this task. You think in way I have this one string and if next one overlap I will add this one character to result. But correct way to think in this case I have this one string and if it overlaps with previous string or what I read so far, I will add one character or characters which are next.
#!/usr/bin/env perl
use strict;
use warnings;
use constant LENGTH => 6;
my $read = <>;
chomp $read;
while (<>) {
chomp;
last unless length > LENGTH;
if ( substr( $read, -LENGTH() ) eq substr( $_, 0, LENGTH ) ) {
$read .= substr( $_, LENGTH );
}
else {last}
}
print $read, "\n";
I didn't get this ARGV[0] thing. It is useless and inflexible.
$ chmod +x code.pl
$ cat data
ATGGAAG
TGGAAGT
GGAAGTC
GAAGTCG
AAGTCGC
AGTCGCG
GTCGCGG
TCGCGGA
CGCGGAA
GCGGAAT
CGGAATC
$ ./code.pl data
ATGGAAGTCGCGGAATC
But you have not defined what should happen if data doesn't overlap. Should there be some recovery or error? You can be also more strict
last unless length == LENGTH + 1;
Edit:
If you like working with an array you should try avoid using for(;;). It is prone to errors. (BTW for (my $i = 0; $i < #a; $i++) is more idiomatic.)
my #short_reads = <>;
chomp #short_reads;
my #all_end_res;
for my $i (1 .. $#short_reads) {
my $prev_read = $short_reads[$i-1];
my $curr_read = $short_reads[$i+1];
my $end_of_kmers = substr($prev_read, -6);
if ( $curr_read =~ /^\Q$end_of_kmers(.)/ ) {
push #all_end_res, $1;
}
}
print $short_reads[0], join('', #all_end_res), "\n";
The performance and memory difference is negligible up to thousands of lines. Now you can ask why to accumulate characters into an array instead of accumulate it to string.
my #short_reads = <>;
chomp #short_reads;
my $read = $short_reads[0];
for my $i (1 .. $#short_reads) {
my $prev_read = $short_reads[$i-1];
my $curr_read = $short_reads[$i+1];
my $end_of_kmers = substr($prev_read, -6);
if ( $curr_read =~ /^\Q$end_of_kmers(.)/ ) {
$read .= $1;
}
}
print "$read\n";
Now the question is why to use $prev_read when you have $end_of_kmers inside of $read.
my #short_reads = <>;
chomp #short_reads;
my $read = $short_reads[0];
for my $i (1 .. $#short_reads) {
my $curr_read = $short_reads[$i+1];
my $end_of_kmers = substr($read, -6);
if ( $curr_read =~ /^\Q$end_of_kmers(.)/ ) {
$read .= $1;
}
}
print "$read\n";
Now you can ask why I need indexes at all. You just should remove the first line to work with the rest of array.
my #short_reads = <>;
chomp #short_reads;
my $read = shift #short_reads;
for my $curr_read (#short_reads) {
my $end_of_kmers = substr($read, -6);
if ( $curr_read =~ /^\Q$end_of_kmers(.)/ ) {
$read .= $1;
}
}
print "$read\n";
And with few more steps and tweaks you will end up with the code what I posted initially. I don't need an array at all because I look only to the current line and accumulator. The difference is in a way how you think about the problem. If you think in terms of arrays and indexes and looping or in terms of data flow, data processing and state/accumulator. With more experience, you don't have to do all those steps and make the final solution just due different approach to problem solving.
Edit2:
It is almost ten times faster using substr and eq then using regular expressions.
$ time ./code.pl data.out > data.test
real 0m0.480s
user 0m0.468s
sys 0m0.008s
$ time ./code2.pl data.out > data2.test
real 0m4.520s
user 0m4.516s
sys 0m0.000s
$ cmp data.test data2.test && echo OK
OK
$ wc -c data.out data.test
6717368 data.out
839678 data.test
with minor modification:
use warnings;
use strict;
open my $in, '<', $ARGV[0] or die $!;
chomp(my #short_reads = <$in>);
my $first_read = $short_reads[0];
my #all_end_res;
for(my $i=0; $i<=$#short_reads; $i++){
chomp $short_reads[$i];
my $end_of_kmers = substr($short_reads[$i], -6);
my ($next_read) = $short_reads[$i+1];
if( (defined $next_read) and ($next_read =~ /^\Q$end_of_kmers/)){
my $end_res = substr($next_read, -1);
push(#all_end_res, $end_res);
}
}
my $end_res2 = join('', #all_end_res);
print $first_read.$end_res2,"\n";
ATGGAAGTCGCGGAATC
Related
I am trying to enhance a perl program I have previously written so that it recognizes top 1000 length 23 k-mers that ends with GG and print out the k-mers that only appears once in the sequence. However, no matter where I add the reg exp, I am unable to get the expected result.
The code I have:
#!/usr/bin/perl
use strict;
use warnings;
my $k = 23;
my $input = 'Fasta.fasta';
my $output = 'Fasta2.fasta';
my $match_count = 0;
#Open File
unless ( open( FASTA, "<", $input ) ) {
die "Unable to open fasta file", $!;
}
#Unwraps the FASTA format file
$/ = ">";
#Separate header and sequence
#Remove spaces
unless ( open( OUTPUT, ">", $output ) ) {
die "Unable to open file", $!;
}
<FASTA>; # discard 'first' 'empty' record
my %seen;
while ( my $line = <FASTA> ) {
chomp $line;
my ( $header, #seq ) = split( /\n/, $line );
my $sequence = join '', #seq;
for ( length($sequence) >= $k ) {
$sequence =~ m/([ACTG]{21}[G]{2})/g;
for my $i ( 0 .. length($sequence) - $k ) {
my $kmer = substr( $sequence, $i, $k );
##while ($kmer =~ m/([ACTG]{21}[G]{2})/g){
$match_count = $match_count + 1;
print OUTPUT ">crispr_$match_count", "\n", "$kmer", "\n" unless $seen{$kmer}++;
}
}
}
The input fasta file looks like this:
> >2L type=chromosome_arm; loc=2L:1..23011544; ID=2L; dbxref=REFSEQ:NT_033779,GB:AE014134; MD5=bfdfb99d39fa5174dae1e2ecd8a231cd; length=23011544; release=r5.54; species=Dmel;
CGACAATGCACGACAGAGGAAGCAGAACAGATATTTAGATTGCCTCTCAT
TTTCTCTCCCATATTATAGGGAGAAATATGATCGCGTATGCGAGAGTAGT
GCCAACATATTGTGCTCTTTGATTTTTTGGCAACCCAAAATGGTGGCGGA
TGAACGAGATGATAATATATTCAAGTTGCCGCTAATCAGAAATAAATTCA
TTGCAACGTTAAATACAGCACAATATATGATCGCGTATGCGAGAGTAGTG
CCAACATATTGTGCTAATGAGTGCCTCTCGTTCTCTGTCTTATATTACCG
CAAACCCAAAAAGACAATACACGACAGAGAGAGAGAGCAGCGGAGATATT
TAGATTGCCTATTAAATATGATCGCGTATGCGAGAGTAGTGCCAACATAT
TGTGCTCTCTATATAATGACTGCCTCTCATTCTGTCTTATTTTACCGCAA
ACCCAAATCGACAATGCACGACAGAGGAAGCAGAACAGATATTTAGATTG
CCTCTCATTTTCTCTCCCATATTATAGGGAGAAATATGATCGCGTATGCG
AGAGTAGTGCCAACATATTGTGCTCTTTGATTTTTTGGCAACCCAAAATG
GTGGCGGATGAACGAGATGATAATATATTCAAGTTGCCGCTAATCAGAAA
TAAATTCATTGCAACGTTAAATACAGCACAATATATGATCGCGTATGCGA
GAGTAGTGCCAACATATTGTGCTAATGAGTGCCTCTCGTTCTCTGTCTTA
TATTACCGCAAACCCAAAAAGACAATACACGACAGAGAGAGAGAGCAGCG
GAGATATTTAGATTGCCTATTAAATATGATCGCGTATGCGAGAGTAGTGC
CAACATATTGTGCTCTCTATATAATGACTGCCTCTCATTCTGTCTTATTT
TACCGCAAACCCAAATCGACAATGCACGACAGAGGAAGCAGAACAGATAT
and so on...
The expected outcome (print out the 23k-mers with GG ending that only appear once in the sequence) I am hoping to get:
>crispr_1
GGGTGGAGCTCCCGAAATGCAGG
>crispr_2
TTAATAAATATTGACACAGCGGG
>crispr_3
ATCGTGGGGCGTTTTGTGAAAGG
>crispr_4
AGTTTTTCACATAATCAGACAGG
>crispr_5
GTGTTGGATGAGTGTCCTCTGGG
>crispr_6
ATAGGTTGGTTGTTTTAAAAGGG
>crispr_7
AAATTTTTGTTGCCACTGAATGG
>crispr_8
AAGTTTCGAACTACGATGGTTGG
>crispr_9
CATGCTTTGTGGAAATAAGTCGG
>crispr_10
CACAGTGGGTGTTTGCACCTCGG
.... and so on
The current code I did create a fasta file with following:
>crispr_1
CGACAATGCACGACAGAGGAAGC
>crispr_2
GACAATGCACGACAGAGGAAGCA
>crispr_3
ACAATGCACGACAGAGGAAGCAG
>crispr_4
CAATGCACGACAGAGGAAGCAGA
>crispr_5
AATGCACGACAGAGGAAGCAGAA
>crispr_6
ATGCACGACAGAGGAAGCAGAAC
>crispr_7
TGCACGACAGAGGAAGCAGAACA
>crispr_8
GCACGACAGAGGAAGCAGAACAG
>crispr_9
CACGACAGAGGAAGCAGAACAGA
>crispr_10
ACGACAGAGGAAGCAGAACAGAT
.... and so on
while if I remove the
for (length($sequence) >=$k){
$sequence =~m/([ACTG]{21}[G]{2})/g;
and add the ##while ($kmer =~ m/([ACTG]{21}[G]{2})/g){
while ($kmer =~ m/([ACTG]{21}[G]{2})/g){
I am getting fasta file (with results which is not numbered correctly and unable to distinguish between duplicated and unique sequences):
>crispr_1
CATTTTCTCTCCCATATTATAGG
>crispr_2
ATTTTCTCTCCCATATTATAGGG
>crispr_3
TATTGTGCTCTTTGATTTTTTGG
>crispr_4
GATTTTTTGGCAACCCAAAATGG
>crispr_5
TTTTTGGCAACCCAAAATGGTGG
>crispr_6
TTGGCAACCCAAAATGGTGGCGG
>crispr_7
ACGACAGAGAGAGAGAGCAGCGG
>crispr_8
AAATCGACAATGCACGACAGAGG
>crispr_91
TATTGTGATCTTCGATTTTTTGG
>crispr_93
TTTTTGGCAACCCAAAATGGAGG
.... and so on
I have attempted to move the regex around my code, but none of them generated the expected result. I do not know what I did wrong over here. I have not add the exit the program when count reaches 1000 into the code yet.
Thanks in advance!
I'm not sure I understand your question completely, but could the following be what you need.
<FASTA>; # discard 'first' 'empty' record
my %data;
while (my $line = <FASTA>){
chomp $line;
my($header, #seq) = split(/\n/, $line);
my $sequence = join '', #seq;
for my $i (0 .. length($sequence) - $k) {
my $kmer = substr($sequence, $i, $k);
$data{$kmer}++ if $kmer =~ /GG$/;
}
}
my $i = 0;
for my $kmer (sort {$data{$b} <=> $data{$a}} keys %data) {
printf "crispr_%d\n%s appears %d times\n", ++$i, $kmer, $data{$kmer};
last if $i == 1000;
}
Some output on a file I have is:
crispr_1
ggttttccggcacccgggcctgg appears 4 times
crispr_2
ccgagctgggcgagaagtagggg appears 4 times
crispr_3
gccgagctgggcgagaagtaggg appears 4 times
crispr_4
gcacccgggcctgggtggcaggg appears 4 times
crispr_5
agcagcgggatcgggttttccgg appears 4 times
crispr_6
gctgggcgagaagtaggggaggg appears 4 times
crispr_7
cccttctgcttcagtgtgaaagg appears 4 times
crispr_8
gtggcagggaagaatgtgccggg appears 4 times
crispr_9
gatcgggttttccggcacccggg appears 4 times
crispr_10
tgagggaaagtgctgctgctggg appears 4 times
crispr_11
agctgggcgagaagtaggggagg appears 4 times
. . . .
ggcacccgggcctgggtggcagg appears 4 times
crispr_50
gaatctctttactgcctggctgg appears 4 times
crispr_51
accacaacattgacagttggtgg appears 2 times
crispr_52
caacattgacagttggtggaggg appears 2 times
crispr_53
catgctcatcgtatctgtgttgg appears 2 times
crispr_54
gattaatgaagtggttattttgg appears 2 times
crispr_55
gaaaccacaacattgacagttgg appears 2 times
crispr_56
aacattgacagttggtggagggg appears 2 times
crispr_57
gacttgatcgattaatgaagtgg appears 2 times
crispr_58
acaacattgacagttggtggagg appears 2 times
crispr_59
gaaccatatattgttatcactgg appears 2 times
crispr_60
ccacagcgcccacttcaaggtgg appears 1 times
crispr_61
ctgctcctgggtgtgagcagagg appears 1 times
crispr_62
ccatatattatctgtggtttcgg appears 1 times
. . . .
Update
To get the results you mentioned in your comment (below), replace the output code with:
my $i = 1;
while (my ($kmer, $count) = each %data) {
next unless $count == 1;
print "crispr_$i\n$kmer\n";
last if $i++ == 1000;
}
To answer my own comment to get first 1000.
<FASTA>; # discard 'first' 'empty' record
my %seen;
my #kmers;
while (my $line = <FASTA>){
chomp $line;
my($header, #seq) = split(/\n/, $line);
my $sequence = join '', #seq;
for my $i (0 .. length($sequence) - $k) {
my $kmer = substr($sequence, $i, $k);
if ($kmer =~ /GG$/) {
push #kmers, $kmer unless $seen{$kmer}++;
}
}
}
my $i = 1;
for my $kmer (#kmers) {
next unless $seen{$kmer} == 1;
print "crispr_$i\n$kmer\n";
last if $i++ == 1000;
}
Answer To check for uniqueness of final 12 chars ending in GG, the code below achieves that.
if ($kmer =~ /(.{10}GG)$/) {
my $substr = $1;
push #kmers, $kmer unless $seen{$substr}++;
}
my $i = 1;
for my $kmer (#kmers) {
my $substr = substr $kmer, -12;
next unless $seen{$substr} == 1;
print "crispr_$i\n$kmer\n";
last if $i++ == 1000;
}
Actually, this code line
$sequence =~m/([ACTG]{21}[G]{2})/g;
this line is just for the regex match, if you try to print this $sequence, it will surely print out the original result.
please add the code segement like this
if($sequence =~/([ACTG]{21}[G]{2}$)/g)
{
}#please remember to match the end with $.
BTW,It looks like the multiple for loop to parse this data is not very reasonable, the parse speed is without the best-efficiency.
I have been stuck with some script!
Well i made this script in 2008 and now i am using with some modifications and i get error!
#!/usr/bin/perl -w
use strict;
use Data::Dumper;
sub getSequences ($) {
my $file = $_[0];
open (INFILE, "<$file") || die "Error1 in opening in file: $file. $!\n";
my #lines = <INFILE>;
my $header; my %header2seq = ();
foreach my $line (#lines) {
chomp $line;
if ($line =~ /^(>.+)$/o) {
$header = $1;
}
else {$header2seq {$header} .= $line; }
}
#print %header2seq;
close (INFILE);
return (\%header2seq);
}
sub MakeSpList ($) {
my $sp_list = $_[0]; my %sp_names = ();
open (INFILE2, "<$sp_list") || die "Error2 in opening in file: $sp_list. $!\n";
my #sps = <INFILE2>;
foreach my $line (#sps) { chomp $line; $sp_names {$line} = 1; }
close (INFILE2);
#print Dumper (%sp_names);
return (\%sp_names);
}
sub CompareSpList2Sequences ($$$) {
my $ref_header2seq = $_[0] ; my $ref_sp_names = $_[1]; my $file = $_[2];
open (OUTFILE, ">$file.subdata") || die ("Error3 in opening out file: $file.subdata. $!\n");
foreach my $key (keys %$ref_header2seq) {
$key =~ m/^>([A-Z]+[0-9]+[A-Z+]).+$/o;
#print "$1\n";
my $header_sub = $1;
#print $header_sub, "\n";
#print $ref_sp_names, "\n";
if (exists $ref_sp_names -> {$header_sub}) {
my $seq = $ref_header2seq -> {$key};
print OUTFILE ">$key\n$seq\n";
}
}
close (OUTFILE);
return "42";
}
my $fasta_seqs = $ARGV[0]; my $sp_list = $ARGV[1];
my $ref_header2seq = getSequences ($fasta_seqs);
my $ref_sp_names = MakeSpList ($sp_list);
CompareSpList2Sequences ($ref_header2seq , $ref_sp_names, $fasta_seqs);
exit;
What i want to do is:
i have a fasta file with sequences:
YAL004W YAL004W SGDID:S000002136, Chr I from 140760-141407, Genome Release 64-2-1, Dubious ORF, "Dubious open reading frame; unlikely to encode a functional protein, based on available experimental and comparative sequence data; completely overlaps verified gene SSA1/YAL005C" ATGGGTGTCACCAGCGGTGGCCTTAACTTCAAAGATACCGTCTTCAATGGACAACAAAGAGACATCGAAAGTACCACCACCCAAGTCGAAAATCAAGACGTGTTCTTCCTTACCCTTCTTGTCCAAACCGTAAGCAATGGCAGCGGCGGTAGGTTCGTTAATAATACGCAAGACATTCAAACCAGCAATGGTACCAGCATCCTTGGTAGCTTGTCTTTGAGAATCGTTGAA
YAL005C SSA1 SGDID:S000000004, Chr I from 141431-139503, Genome Release 64-2-1, reverse complement, Verified ORF, "ATPase involved in protein folding and NLS-directed nuclear transport; member of HSP70 family; forms chaperone complex with Ydj1p; localized to nucleus, cytoplasm, and cell wall; 98% identical with paralog Ssa2p, but subtle differences between the two proteins provide functional specificity with respect to propagation of yeast [URE3] prions and vacuolar-mediated degradations of gluconeogenesis enzymes; general targeting factor of Hsp104p to prion fibrils" ATGTCAAAAGCTGTCGGTATTGATTTAGGTACAACATACTCGTGTGTTGCTCACTTTGCTAATGATCGTGTGGACATTATTGCCAACGATCAAGGTAACAGAACCACTCCATCTTTTGTCGCTTTCACTGACACTGAAAGATTGATTGGTGATGCTGCTAAGAATCAAGCTGCTATGAATCCTTCGAATACCGTTTTCGACGCTAAGCGTTTGATCGGTAGAAACTTCAAC
and i have another file with ID's:
YAL005C
YAL012W
I want to retrieve the sequences and the all header when match with ID's file.
but i get this error: don´t print anything!
Please can you help me?
Thanks in advance.
i already searched for other methods (and i can´t get the results either) but i really want to know about this error!
no bioperl please!
OK, so - line 45 is:
if (exists $ref_sp_names -> {$header_sub}) {
Your error is telling you that $header_sub is undefined. It's set by:
my $header_sub = $1;
Which follows:
$key =~ m/^(>[A-Z])\s.+$/o;
So - this means the regex isn't matching. I don't see any > in your sample data, so it can't match it. When the match fails, $1 is undefined, hence your error. What do you get out of your print $key statements?
I would also note - .+$ is most likely redundant. Likewise - the o flag - you probably don't want that either. http://perldoc.perl.org/perlre.html#Modifiers
have you tried using Bioperl? Here's some code to get you started.
#!/usr/bin/perl
use warnings;
use strict;
use Bio::SeqIO;
my $fasta = shift; #this will just push whatever in cli in.
my $seqio_obj = Bio::SeqIO->(-file => $fasta, -format => 'fasta');
while ( my $seq = $seqio_obj->next_seq){
print $seq->id . ' = ' . $seq->seq() . "\n";
#in here you can do your fasta handling with the seq obj
}
I have the following script which searches for specified substrings within an input string (a DNA sequence). I was wondering if anybody could help out with being able to specify degeneracy of specific characters. For example, instead of searching for GATC (or anything consisting solely of G's, T's, A's and C's), I could instead search for GRTNA where R = A or G and where N = A, G, C or T. I would need to be able to specify quite a few of these in a long list within the script. Many thanks for any help or tips!
use warnings;
use strict;
#User Input
my $usage = "Usage (OSX Terminal): perl <$0> <FASTA File> <Results Directory + Filename>\n";
#Reading formatted FASTA/FA files
sub read_fasta {
my ($in) = #_;
my $sequence = "";
while(<$in>) {
my $line = $_;
chomp($line);
if($line =~ /^>/){ next }
else { $sequence .= $line }
}
return(\$sequence);
}
#Scanning for restriction sites and length-output
open(my $in, "<", shift);
open(my $out, ">", shift);
my $DNA = read_fasta($in);
print "DNA is: \n $$DNA \n";
my $len = length($$DNA);
print "\n DNA Length is: $len \n";
my #pats=qw( GTTAAC );
for (#pats) {
my $m = () = $$DNA =~ /$_/gi;
print "\n Total DNA matches to $_ are: $m \n";
}
my $pat=join("|",#pats);
my #cutarr = split(/$pat/, $$DNA);
for (#cutarr) {
my $len = length($_);
print $out "$len \n";
}
close($out);
close($in);
GRTNA would correspond to the pattern G[AG]T[AGCT]A.
It looks like you could do this by writing
for (#pats) {
s/R/[AG]/g;
s/N/[AGCT]/g;
}
before
my $pat = join '|', #pats;
my #cutarr = split /$pat/, $$DNA;
but I'm not sure I can help you with the requirement that "I would need to be able to specify quite a few of these in a long list within the script". I think it would be best to put your sequences in a separate text file rather than embed the list directly into the program.
By the way, wouldn't it be simpler just to
return $sequence
from your read_fasta subroutine? Returning a reference just means you have to dereference it everywhere with $$DNA. I suggest that it should look like this
sub read_fasta {
my ($fh) = #_;
my $sequence;
while (<$fh>) {
unless (/^>/) {
chomp;
$sequence .= $_;
}
}
return $sequence;
}
[perl 5.8.8]
I have a sequence of names of things like:
names='foobar1304,foobar1305,foobar1306,foobar1307'
where the names differ only by a contiguous string of digits somewhere in the name. The strings of digits in any sequence are all of the same length, and the digit strings form a continuous numeric sequence with no skips, e.g. 003,004,005.
I want a compact representation like:
compact_name='foobar1304-7'
(The compact form is just a name, so it's exact form is negotiable.)
There will usually only be <10 things, though some sets might span a decade, e.g.
'foobaz2205-11'
Is there some concise way to do this in perl? I'm not a big perl hacker, so be a little gentle...
Bonus points for handling embedded sequences like:
names='foobar33-pqq,foobar34-pqq,foobar35-pqq'
The ideal script would neatly fall back to 'firstname2301-lastname9922' in case it can't identify a sequence in the names.
I am not sure I got your specification, but it works somehow:
#!/usr/bin/perl
use warnings;
use strict;
use Test::More;
sub compact {
my $string = shift;
my ($name, $value) = split /=/, $string;
$name =~ s/s$// or die "Cannot create compact name for $name.\n"; #/ SO hilite bug
$name = 'compact_' . $name;
$value =~ s/^'|'$//g; #/ SO hilite bug
my #values = split /,/, $value; #/ SO hilite bug
my ($prefix, $first, $suffix) = $values[0] =~ /^(.+?)([0-9]+)(.*)$/;
my $last = $first + $#values;
my $same = 0;
$same++ while substr($first, 0, $same) eq substr($last, 0, $same);
$last = substr $last, $same - 1;
for my $i ($first .. $first + $#values) {
$values[$i - $first] eq ($prefix . $i . $suffix)
or die "Invalid sequence at $values[$i-$first].\n";
}
return "$name='$prefix$first-$last$suffix'";
}
is( compact("names='foobar1304,foobar1305,foobar1306,foobar1307'"),
"compact_name='foobar1304-7'");
is( compact("names='foobaz2205,foobaz2206,foobaz2207,foobaz2208,foobaz2209,foobaz2210,foobaz2211'"),
"compact_name='foobaz2205-11'");
is( compact("names='foobar33-pqq,foobar34-pqq,foobar35-pqq'"),
"compact_name='foobar33-5-pqq'");
done_testing();
Someone sure will post an more elegant solution, but the following
use strict;
use warnings;
my $names='foobar1308-xy,foobar1309-xy,foobar1310-xy,foobar1311-xy';
my #names = split /,/,$names;
my $pfx = lcp(#names);
my #nums = map { m/$pfx(\d*)/; $1 } #names;
my $first=shift #nums;
my $last = pop #nums;
my $suf=$names[0];
$suf =~ s/$pfx\d*//;
print "$pfx\{$first-$last}$suf\n";
#https://gist.github.com/3309172
sub lcp {
my $match = shift;
substr($match, (($match ^ $_) =~ /^\0*/, $+[0])) = '' for #_;
$match;
}
prints:
foobar13{08-11}-xy
Edit: solution added.
Hi, I currently have some working albeit slow code.
It merges 2 CSV files line by line using a primary key.
For example, if file 1 has the line:
"one,two,,four,42"
and file 2 has this line;
"one,,three,,42"
where in 0 indexed $position = 4 has the primary key = 42;
then the sub: merge_file($file1,$file2,$outputfile,$position);
will output a file with the line:
"one,two,three,four,42";
Every primary key is unique in each file, and a key might exist in one file but not in the other (and vice versa)
There are about 1 million lines in each file.
Going through every line in the first file, I am using a hash to store the primary key, and storing the line number as the value. The line number corresponds to an array[line num] which stores every line in the first file.
Then I go through every line in the second file, and check if the primary key is in the hash, and if it is, get the line from the file1array and then add the columns I need from the first array to the second array, and then concat. to the end. Then delete the hash, and then at the very end, dump the entire thing to file. (I am using a SSD so I want to minimise file writes.)
It is probably best explained with a code:
sub merge_file2{
my ($file1,$file2,$out,$position) = ($_[0],$_[1],$_[2],$_[3]);
print "merging: \n$file1 and \n$file2, to: \n$out\n";
my $OUTSTRING = undef;
my %line_for;
my #file1array;
open FILE1, "<$file1";
print "$file1 opened\n";
while (<FILE1>){
chomp;
$line_for{read_csv_string($_,$position)}=$.; #reads csv line at current position (of key)
$file1array[$.] = $_; #store line in file1array.
}
close FILE1;
print "$file2 opened - merging..\n";
open FILE2, "<", $file2;
my #from1to2 = qw( 2 4 8 17 18 19); #which columns from file 1 to be added into cols. of file 2.
while (<FILE2>){
print "$.\n" if ($.%1000) == 0;
chomp;
my #array1 = ();
my #array2 = ();
my #array2 = split /,/, $_; #split 2nd csv line by commas
my #array1 = split /,/, $file1array[$line_for{$array2[$position]}];
# ^ ^ ^
# prev line lookup line in 1st file,lookup hash, pos of key
#my #output = &merge_string(\#array1,\#array2); #merge 2 csv strings (old fn.)
foreach(#from1to2){
$array2[$_] = $array1[$_];
}
my $outstring = join ",", #array2;
$OUTSTRING.=$outstring."\n";
delete $line_for{$array2[$position]};
}
close FILE2;
print "adding rest of lines\n";
foreach my $key (sort { $a <=> $b } keys %line_for){
$OUTSTRING.= $file1array[$line_for{$key}]."\n";
}
print "writing file $out\n\n\n";
write_line($out,$OUTSTRING);
}
The first while is fine, takes less than 1 minute, however the second while loop takes about 1 hour to run, and I am wondering if I have taken the right approach. I think it is possible for a lot of speedup? :) Thanks in advance.
Solution:
sub merge_file3{
my ($file1,$file2,$out,$position,$hsize) = ($_[0],$_[1],$_[2],$_[3],$_[4]);
print "merging: \n$file1 and \n$file2, to: \n$out\n";
my $OUTSTRING = undef;
my $header;
my (#file1,#file2);
open FILE1, "<$file1" or die;
while (<FILE1>){
if ($.==1){
$header = $_;
next;
}
print "$.\n" if ($.%100000) == 0;
chomp;
push #file1, [split ',', $_];
}
close FILE1;
open FILE2, "<$file2" or die;
while (<FILE2>){
next if $.==1;
print "$.\n" if ($.%100000) == 0;
chomp;
push #file2, [split ',', $_];
}
close FILE2;
print "sorting files\n";
my #sortedf1 = sort {$a->[$position] <=> $b->[$position]} #file1;
my #sortedf2 = sort {$a->[$position] <=> $b->[$position]} #file2;
print "sorted\n";
#file1 = undef;
#file2 = undef;
#foreach my $line (#file1){print "\t [ #$line ],\n"; }
my ($i,$j) = (0,0);
while ($i < $#sortedf1 and $j < $#sortedf2){
my $key1 = $sortedf1[$i][$position];
my $key2 = $sortedf2[$j][$position];
if ($key1 eq $key2){
foreach(0..$hsize){ #header size.
$sortedf2[$j][$_] = $sortedf1[$i][$_] if $sortedf1[$i][$_] ne undef;
}
$i++;
$j++;
}
elsif ( $key1 < $key2){
push(#sortedf2,[#{$sortedf1[$i]}]);
$i++;
}
elsif ( $key1 > $key2){
$j++;
}
}
#foreach my $line (#sortedf2){print "\t [ #$line ],\n"; }
print "outputting to file\n";
open OUT, ">$out";
print OUT $header;
foreach(#sortedf2){
print OUT (join ",", #{$_})."\n";
}
close OUT;
}
Thanks everyone, the solution is posted above. It now takes about 1 minute to merge the whole thing! :)
Two techniques come to mind.
Read the data from the CSV files into two tables in a DBMS (SQLite would work just fine), and then use the DB to do a join and write the data back out to CSV. The database will use indexes to optimize the join.
First, sort each file by primary key (using perl or unix sort), then do a linear scan over each file in parallel (read a record from each file; if the keys are equal then output a joined row and advance both files; if the keys are unequal then advance the file with the lesser key and try again). This step is O(n + m) time instead of O(n * m), and O(1) memory.
What's killing the performance is this code, which is concatenating millions of times.
$OUTSTRING.=$outstring."\n";
....
foreach my $key (sort { $a <=> $b } keys %line_for){
$OUTSTRING.= $file1array[$line_for{$key}]."\n";
}
If you want to write to the output file only once, accumulate your results in an array, and then print them at the very end, using join. Or, even better perhaps, include the newlines in the results and write the array directly.
To see how concatenation does not scale when crunching big data, experiment with this demo script. When you run it in concat mode, things start slowing down considerably after a couple hundred thousand concatenations -- I gave up and killed the script. By contrast, simply printing an array of a million lines took less than a than a minute on my machine.
# Usage: perl demo.pl 50 999999 concat|join|direct
use strict;
use warnings;
my ($line_len, $n_lines, $method) = #ARGV;
my #data = map { '_' x $line_len . "\n" } 1 .. $n_lines;
open my $fh, '>', 'output.txt' or die $!;
if ($method eq 'concat'){ # Dog slow. Gets slower as #data gets big.
my $outstring;
for my $i (0 .. $#data){
print STDERR $i, "\n" if $i % 1000 == 0;
$outstring .= $data[$i];
}
print $fh $outstring;
}
elsif ($method eq 'join'){ # Fast
print $fh join('', #data);
}
else { # Fast
print $fh #data;
}
If you want merge you should really merge. First of all you have to sort your data by key and than merge! You will beat even MySQL in performance. I have a lot of experience with it.
You can write something along those lines:
#!/usr/bin/env perl
use strict;
use warnings;
use Text::CSV_XS;
use autodie;
use constant KEYPOS => 4;
die "Insufficient number of parameters" if #ARGV < 2;
my $csv = Text::CSV_XS->new( { eol => $/ } );
my $sortpos = KEYPOS + 1;
open my $file1, "sort -n -k$sortpos -t, $ARGV[0] |";
open my $file2, "sort -n -k$sortpos -t, $ARGV[1] |";
my $row1 = $csv->getline($file1);
my $row2 = $csv->getline($file2);
while ( $row1 and $row2 ) {
my $row;
if ( $row1->[KEYPOS] == $row2->[KEYPOS] ) { # merge rows
$row = [ map { $row1->[$_] || $row2->[$_] } 0 .. $#$row1 ];
$row1 = $csv->getline($file1);
$row2 = $csv->getline($file2);
}
elsif ( $row1->[KEYPOS] < $row2->[KEYPOS] ) {
$row = $row1;
$row1 = $csv->getline($file1);
}
else {
$row = $row2;
$row2 = $csv->getline($file2);
}
$csv->print( *STDOUT, $row );
}
# flush possible tail
while ( $row1 ) {
$csv->print( *STDOUT, $row1 );
$row1 = $csv->getline($file1);
}
while ( $row2 ) {
$csv->print( *STDOUT, $row2 );
$row2 = $csv->getline($file1);
}
close $file1;
close $file2;
Redirect output to file and measure.
If you like more sanity around sort arguments you can replace file opening part with
(open my $file1, '-|') || exec('sort', '-n', "-k$sortpos", '-t,', $ARGV[0]);
(open my $file2, '-|') || exec('sort', '-n', "-k$sortpos", '-t,', $ARGV[1]);
I can't see anything that strikes me as obviously slow, but I would make these changes:
First, I'd eliminate the #file1array variable. You don't need it; just store the line itself in the hash:
while (<FILE1>){
chomp;
$line_for{read_csv_string($_,$position)}=$_;
}
Secondly, although this shouldn't really make much of a difference with perl, I wouldn't add to $OUTSTRING all the time. Instead, keep an array of output lines and push onto it each time. If for some reason you still need to call write_line with a massive string you can always use join('', #OUTLINES) at the end.
If write_line doesn't use syswrite or something low-level like that, but rather uses print or other stdio-based calls, then you aren't saving any disk writes by building up the output file in memory. Therefore, you might as well not build your output up in memory at all, and instead just write it out as you create it. Of course if you are using syswrite, forget this.
Since nothing is obviously slow, try throwing Devel::SmallProf at your code. I've found that to be the best perl profiler for producing those "Oh! That's the slow line!" insights.
Assuming around 20 bytes lines each of your file would amount to about 20 MB, which isn't too big.
Since you are using hash your time complexity doesn't seem to be a problem.
In your second loop, you are printing to the console for each line, this bit is slow. Try removing that should help a lot.
You can also avoid the delete in the second loop.
Reading multiple lines at a time should also help. But not too much I think, there is always going to be a read ahead behind the scenes.
I'd store each record in a hash whose keys are the primary keys. A given primary key's value is a reference to an array of CSV values, where undef represents an unknown value.
use 5.10.0; # for // ("defined-or")
use Carp;
use Text::CSV;
sub merge_csv {
my($path,$record) = #_;
open my $fh, "<", $path or croak "$0: open $path: $!";
my $csv = Text::CSV->new;
local $_;
while (<$fh>) {
if ($csv->parse($_)) {
my #f = map length($_) ? $_ : undef, $csv->fields;
next unless #f >= 1;
my $primary = pop #f;
if ($record->{$primary}) {
$record->{$primary}[$_] //= $f[$_]
for 0 .. $#{ $record->{$primary} };
}
else {
$record->{$primary} = \#f;
}
}
else {
warn "$0: $path:$.: parse failed; skipping...\n";
next;
}
}
}
Your main program will resemble
my %rec;
merge_csv $_, \%rec for qw/ file1 file2 /;
The Data::Dumper module shows that the resulting hash given the simple inputs from your question is
$VAR1 = {
'42' => [
'one',
'two',
'three',
'four'
]
};