Extracting and joining exons from multiple sequence alignments - perl

Question

Using my (fairly) basic coding skills, I have put together a script that will parse an aligned multi-fasta file (a multiple sequence alignment) and extract all the data between two specified columns.
use Bio::SimpleAlign;
use Bio::AlignIO;
$str = Bio::AlignIO->new(-file => $inputfilename, -format => 'fasta');
$aln = $str->next_aln();
$mini = $aln->slice($array[0], $array[1]);
$out = Bio::AlignIO->new(-file => $array[3], -format => 'fasta');
$out->write_aln($mini);
The problem I have is that I want to be able to slice multiple regions from the same alignment and then join these regions prior to writing to an outfile. The complication is that I want to supply a file with a list of co-ordinates where each line contains two or more co-ordinates between which data should be extracted and joined.
Here is an example co-ordinate file
ORF1, 10, 50, exon1 # The above line should produce a slice between columns 10-50 and write to an outfile
ORF2, 70, 140, exon1
ORF2, 190, 270, exon2
ORF2, 500, 800, exon3 # Data should be extracted between the ranges specified here and in the above two lines and then joined (side by side) to produce the outfile.
ORF3, 1200, 1210, exon1
etc etc
And here is an (small) example of an aligned fasta file
\>Sample1
ATGGCGACCGTGCACTACTCCCGCCGACCTGGGACCCCGCCGGTCACCCTCACGTCGTCC
CCCAGCATGGATGACGTTGCGACCCCCATCCCCTACCTACCCACATACGCCGAGGCCGTG
GCAGACGCGCCCCCCCCTTACAGAAGCCGCGAGAGTCTGGTGTTCTCCCCGCCTCTTTTT
CCTCACGTGGAGAATGGCACCACCCAACAGTCTTACGATTGCCTAGACTGCGCTTATGAT
GGAATCCACAGACTTCAGCTGGCTTTTCTAAGAATTCGCAAATGCTGTGTACCGGCTTTT
TTAATTCTTTTTGGTATTCTCACCCTTACTGCTGTCGTGGTCGCCATTGTTGCCGTTTTT
CCCGAGGAACCTCCCAACTCAACTACATGA
\>Sample2
ATGGCGACCGTGCACTACTCCCGCCGACCTGGGACCCCGCCGGTCACCCTCACGTCGTCC
CCCAGCATGGATGACGTTGCGACCCCCATCCCCTACCTACCCACATACGCCGAGGCCGTG
GCAGACGCGCCCCCCCCTTACAGAAGCCGCGAGAGTCTGGTGTTCTCCCCGCCTCTTTTT
CCTCACGTGGAGAATGGCACCACCCAACAGTCTTACGATTGCCTAGACTGCGCTTATGAT
GGAATCCACAGACTTCAGCTGGCTTTTCTAAGAATTCGCAAATGCTGTGTACCGGCTTTT
TTAATTCTTTTTGGTATTCTCACCCTTACTGCTGTCGTGGTCGCCATTGTTGCCGTTTTT
CCCGAGGAACCTCCCAACTCAACTACATGA
I think there should be a fairly simple way to solve this problem, potentially using the information in the first column, paired with the exon number, but I can't for the life of me figure out how this can be done.
Can anyone help me out?

Answer 1

The aligned fasta file you posted -- at least as it appears on the stackoverflow web page -- did not compile. According to https://en.wikipedia.org/wiki/FASTA_format, the description lines should begin with a >, not with \>.
Be sure to run all Perl programs with use strict; use warnings;. This will facilitate debugging.
You have not populated #array. Consequently, you can expect to get errors like these:
Use of uninitialized value $start in pattern match (m//) at perl-5.24.0/lib/site_perl/5.24.0/Bio/SimpleAlign.pm line 1086, <GEN0> line 16.
Use of uninitialized value $start in concatenation (.) or string at perl-5.24.0/lib/site_perl/5.24.0/Bio/SimpleAlign.pm line 1086, <GEN0> line 16.
------------- EXCEPTION: Bio::Root::Exception -------------
MSG: Slice start has to be a positive integer, not []
STACK: Error::throw
STACK: Bio::Root::Root::throw perl-5.24.0/lib/site_perl/5.24.0/Bio/Root/Root.pm:444
STACK: Bio::SimpleAlign::slice perl-5.24.0/lib/site_perl/5.24.0/Bio/SimpleAlign.pm:1086
STACK: fasta.pl:26
Once you assign plausible values, e.g.,
#array = (1,17);
... you will get more plausible results:
$ perl fasta.pl
>Sample1/1-17
ATGGCGACCGTGCACTA
>Sample2/1-17
ATGGCGACCGTGCACTA
HTH!