Issues with subroutine Perl - perl

I'm trying to execute a Perl program, but the window only closes up. But if I select a part of the window, it stays open, and I press Enter and says
Undefined subroutine &genNumeros::crearNumero called at .... at line 17
genNumeros.pm
package genNumeros;
use strict;
use warnings;
use Math::Complex;
my $seed = time();
my $a = $seed / 5;
my $c = $seed - 7;
my $x = $seed;
my $m = sqrt($seed % 574) + $seed;
my $numAleatorio;
sub generadorMultiplicativo {
$numAleatorio = ((($a*$x) + $c) % $m);
$x = $numAleatorio;
}
my $letra;
my $residuo;
sub crearNumero {
generadorMultiplicativo();
$residuo = $x / $m;
return int($residuo * 27)
}
1;
main.pl
#!/usr/bin/perl
use warnings;
use FindBin;
use lib $FindBin::Bin;
use genNumeros;
my #palabra;
open (my $ARCHIVO, '<', "palabras.txt") or die ("No se encontro el archivo palabras.txt, $!");
while (my $palabra = <$ARCHIVO>) {
chomp $palabra;
push #palabra, $palabra;
}
close $ARCHIVO;
my $palabraAleatoria = $palabra[ genNumeros::crearNumero() ];
print "$palabraAleatoria\n";
<>;

Your package name and the corresponding file name should use capital letters, and local names should be all lower case
So your library should be in file GenNumeros.pm, and should start with package GenNumeros
It should define subroutines generador_multiplicativo and crear_numero
Your main program file should use GenNumeros
The usual way to import identifiers is to use Exporter in your library code, but fully-qualifying the subroutines, like GenNumeros::generador_multiplicativo is also fine

Related

How to make external command's output autoflush with AnyEvent::Subprocess?

I am trying to monitor the output of an external command with AnyEvent::Subprocess:
use feature qw(say);
use strict;
use warnings;
use AnyEvent::Subprocess;
my $job = AnyEvent::Subprocess->new(
delegates => [ 'StandardHandles', 'CompletionCondvar' ],
code => 'myscript.pl',
);
my $run = $job->run;
my $condvar = $run->delegate('completion_condvar');
$run->delegate('stdout')->handle->on_read(
sub {
my ( $handle ) = #_;
my $line = $handle->rbuf;
chomp $line;
say "Got output: '$line'";
$handle->rbuf = ""; # clear buffer
}
);
my $done = $condvar->recv;
In general, I do not have access to the source code of the external script, so I cannot insert commands like STDOUT->autoflush(1) into the script (if the script happens to be a Perl script).
Here is the test script I used for testing:
myscript.pl:
use feature qw(say);
use strict;
use warnings;
#STDOUT->autoflush(1);
sleep 1;
say "data 1";
sleep 1;
say "data 2";
sleep 1;
say "data 3";
The output is coming all at once after myscript.pl finishes. I want to print each line from myscript.pl as it becomes available. How can this be done without modifying myscript.pl ?

Undefined subroutines &main error in Perl

I am trying to extract a DNA sequence from this FASTA file to a specified length of bases per line, say 40.
> sample dna (This is a typical fasta header.)
agatggcggcgctgaggggtcttgggggctctaggccggccacctactgg
tttgcagcggagacgacgcatggggcctgcgcaataggagtacgctgcct
gggaggcgtgactagaagcggaagtagttgtgggcgcctttgcaaccgcc
tgggacgccgccgagtggtctgtgcaggttcgcgggtcgctggcgggggt
Using this Perl module (fasta.pm):
package fasta;
use strict;
sub read_fasta ($filename) {
my $filename = #_;
open (my $FH_IN, "<", $filename) or die "Can't open file: $filename $!";
my #lines = <$FH_IN>;
chomp #lines;
return #lines;
}
sub read_seq (\#lines) {
my $linesRef = #_;
my #lines = #{$linesRef};
my #seq;
foreach my $line (#lines) {
if ($line!~ /^>/) {
print "$line\n";
push (#seq, $line);
}
}
return #seq;
}
sub print_seq_40 (\#seq) {
my $linesRef = #_;
my #lines = #{$linesRef};
my $seq;
foreach my $line (#lines) {
$seq = $seq.$line;
}
my $i= 0;
my $seq_line;
while (($i+1)*40 < length ($seq)) {
my $seq_line = substr ($seq, $i*40, 40);
print "$seq_line\n";
$i++;
}
$seq_line = substr ($seq, $i*40);
print "$seq_line\n";
}
1;
And the main script is
use strict;
use warnings;
use fasta;
print "What is your filename: ";
my $filename = <STDIN>;
chomp $filename;
my #lines = read_fasta ($filename);
my #seq = read_seq (\#lines);
print_seq_40 (\#seq);
exit;
This is the error I get
Undefined subroutine &main::read_fasta called at q2.pl line 13, <STDIN> line 1.
Can anyone please enlighten me on which part I did wrong?
It looks like you're getting nowhere with this.
I think your choice to use a module and subroutines is a little strange, given that you call each subroutine only once and the correspond to very little code indeed.
Both your program and your module need to start with use strict and use warnings, and you cannot use prototypes like that in Perl subroutines. Including a number of other bugs, this is a lot closer to the code that you need.
package Fasta;
use strict;
use warnings;
use 5.010;
use autodie;
use base 'Exporter';
our #EXPORT = qw/ read_fasta read_seq print_seq_40 /;
sub read_fasta {
my ($filename) = #_;
open my $fh_in, '<', $filename;
chomp(my #lines = <$fh_in>);
#lines;
}
sub read_seq {
my ($lines_ref) = $_[0];
grep { not /^>/ } #$lines_ref;
}
sub print_seq_40 {
my ($lines_ref) = #_;
print "$_\n" for unpack '(A40)*', join '', #$lines_ref;
}
1;
q2.pl
use strict;
use warnings;
use Fasta qw/ read_fasta read_seq print_seq_40 /;
print "What is your filename: ";
my $filename = <STDIN>;
chomp $filename;
my #lines = read_fasta($filename);
my #seq = read_seq(\#lines);
print_seq_40(\#seq);
You need to either:
add to your module:
use Exporter;
our #EXPORT = qw ( read_fasta
read_seq ); #etc.
call the code in the remote module explicitly:
fasta::read_fasta();
explicitly import the module sub:
use fasta qw ( read_fasta );
Also: General convention on modules is to uppercase the first letter of the module name.
In Perl, if you use fasta;, this does not automatically export all its methods into the namespace of your program. Call fasta::read_fasta instead.
Or: use Exporter to automatically export methods or enable something like use Fasta qw/read_fasta/.
For example:
package Fasta;
require Exporter;
our #ISA = qw(Exporter);
our #EXPORT_OK = qw/read_fasta read_seq read_seq40/;
To use:
use Fasta qw/read_fasta read_seq read_seq40/;
You can also make Fasta export all methods automatically or define keywords to group methods, though the latter has caused me some problems in the past, and I would recommend it only if you are certain it is worth possible trouble.
If you want to make all methods available:
package Fasta;
use Exporter;
our #ISA = qw(Exporter);
our #EXPORT = qw/read_fasta read_seq read_seq40/;
Note #EXPORT is not #EXPORT_OK. The latter allows importing them later (as I did), the former automatically exports all. The documentation I linked to makes this clear.
I just noticed something else. You are flattening #_ into $filename in read_fasta. I am not sure this works. Try this:
sub read_fasta {
my $filename = $_[0]; # or ($filename) = #_; #_ is an array. $filename not.
}
To explain the problem: $filename = #_; means: store #_ ( an ARRAY ) into $filename (a SCALAR). Perl does this in this way: ARRAY length is stored in $filename. That is not what you want. You want the first element of the array. That would be $_[0].
Added #ISA which is probably needed OR use comment by Borodir.

Push to array not working inside loop

AIM:
I am trying to count a value in "column" 20 in a text file, then print the number of occurrences with the values from the line in the text file. Some of the lines will be identical, with the exception of "column" 0 (first column). I am trying to use hashes (though I have limited understanding of how to use hashes).
PROBLEM:
While doing push in a sub function (inside a foreach loop) the value is not being pushed to an array outside the loop, and hence the output will not be saved to file. Printing inside of the loop works (print $dummy) and all the data is being displayed.
INPUT:
Filename1 Value1a Value2a Value3a ... Column20a ... ColumnENDa
Filename2 Value1b Value2b Value3b ... Column20b ... ColumnENDb
Filename3 Value1c Value2c Value3c ... Column20a ... ColumnENDc
...
OUTPUT (using print $dummy inside loop):
2 Column20a Filename1, Filename3
1 Column20b Filename2
...
CODE:
use strict;
use warnings;
use Cwd;
use File::Find::Rule;
use File::Spec;
use File::Basename;
use Text::Template;
use File::Slurp;
use List::MoreUtils qw(uniq);
my $current_dir = cwd;
my #test_file = read_file ("test_file.txt");
my %count = ();
my %name = ();
my #test = "Counts\tName\tFile_names";
foreach (#test_file) {
chomp $_;
our(#F) = split('\t', $_, 0);
++$count{"$F[20] "};
$name{"$F[20] "} .= "$F[0]," if $F[20];
sub END {
foreach $_ (keys %name) {
$name{$_} =~ s/,$//;
my $dummy = "$count{$_}\t $_\t $name{$_}\n";
#print $dummy;
push (#test, $dummy);
}
};
}
print "#test";
write_file( 'test.txt', #test);
Why is the push function not working outside the sub (foreach loop)?
You're not actually calling your sub.
If you meant it to be the END block, it shouldn't be a sub - and you should not use END blocks unless there's a technical reason to do so.
If you mean it to be a sub, name it something else and actually call it (the name isn't an error, just looks bad - END has special meaning).
The end of your code would be (without fixing/improving it):
foreach (#test_file) {
chomp $_;
our(#F) = split('\t', $_, 0);
++$count{$F[20]};
$name{$F[20]} .= "$F[0]," if $F[20];
}
process_test();
print "#test";
write_file( 'test.txt', #test);
##########################
sub process_test {
foreach $_ (keys %name) {
$name{$_} =~ s/,$//;
my $dummy = "$count{$_}\t $_\t $name{$_}\n";
push (#test, $dummy);
}
}
As an alternative, don't even have a sub (it's not necessary for a couple of lines of code :)
foreach (#test_file) {
chomp $_;
our(#F) = split('\t', $_, 0);
++$count{$F[20]};
$name{$F[20]} .= "$F[0]," if $F[20];
}
foreach $_ (keys %name) {
$name{$_} =~ s/,$//;
my $dummy = "$count{$_}\t $_\t $name{$_}\n";
push (#test, $dummy);
}
print "#test";
write_file('test.txt', #test);
I tested this on my own version of your code, and got the following in the output file using your test input:
Counts Name File_names
2 Column20a Filename1,Filename3
1 Column20b Filename2
Why do you code the subroutine in the foreach-loop? So for every iteration through your loop you create a new one.
There is also a problem with the name of you subroutine. Actually you don't call it. And you can't call it, because perl uses END for the END block. Let me show you this with an example:
use warnings;
use strict;
END('hello world');
sub END{
my $string = shift;
print $string;
}
The purpose of the END block is to do everything between the brackets when the program ends, therefore the name.
use warnings;
use strict;
END('hello world');
sub END{
my $string = shift;
print $string;
}
Either you omit the subroutine or you declare it in a global context e.g. at the end of the program.

Why is my for loop an illegal declaration

I created two subs one to do Fibonacci and the other to test even numbers. When I call it though it is saying my for loop in line 7 the sub Fibonacci is illegal why?
#!/usr/bin/perl
use strict;
use warnings;
my ($x,$y);
my $num = 0;
sub Fibs($start,$stop){
for ($start..$stop){
($x, $y) = ($y, $x+$y);
my $total += $y;
}
print "$total \n"
}
sub even($num){
if ($num % 2 == 0){
return $num;}
}
my $big_total = Fibs(even($num), 3999999)
Edited from suggestions below.
Clearly I am missing something. From feedback updated to new version.
#!/usr/bin/perl
use strict;
use warnings;
my ($x,$y);
my $num = 0;
sub Fibs{
my ($start, $stop) = #_ ;
for ($start..$stop){
my ($x, $y) = (0,2);
if ($x % 2 == 0){
($x, $y) = ($y, $x+$y);
my $total += $y;
}
}
my $big_total = Fibs(0, 3999999)
In addition to the missing opening braces, Perl doesn't support that kind of declaration for subroutine parameters.
Rather than
sub Fibs($start, $stop) {
...
}
you need to write something like:
sub Fibs {
my($start, $stop) = #_;
...
}
(Perl does have prototypes, but they're not really intended for declaring the types of parameters, and they don't provide names. See this article for a discussion.)
Other problems:
You should add
use strict;
use warnings;
You never use the $x and $y that you declare in the outer scope.
Your even function appears to be incomplete. It doesn't (explicitly) return a value if its argument is an odd number. What exactly is it intended to do?

How to make LWP and HTML::TableExtract spitting out CSV with Text::CSV

I am currently working on a little parser.
i have had very good results with the first script! This was able to run great!
It fetches the data from the page: http://192.68.214.70/km/asps/schulsuche.asp?q=n&a=20
(note 6142 records) - But note - the data are not separated, so the subequent work with the data is a bit difficult. Therefore i have a second script - see below!
Note - friends helped me with the both scripts. I need to introduce myself as a true novice who needs help in migration two in one. So, you see, my Perl-knowlgedge is not so elaborated that i am able to do the migration into one on my own! Any and all help would be great!
The first script: a spider and parser: it spits out the data like this:
lfd. Nr. Schul- nummer Schulname Straße PLZ Ort Telefon Fax Schulart Webseite
1 0401 Mädchenrealschule Marienburg, Abenberg, der Diözese Eichstätt Marienburg 1 91183  Abenberg  09178/509210 Realschulen mrs-marienburg.homepage.t-online.de
2 6581 Volksschule Abenberg (Grundschule) Güssübelstr. 2 91183  Abenberg  09178/215 09178/905060 Volksschulen home.t-online.de/home/vs-abenberg
3 6913 Mittelschule Abenberg  Güssübelstr. 2 91183  Abenberg  09178/215 09178/905060 Volksschulen home.t-online.de/home/vs-abenberg
4 0402 Johann-Turmair-Realschule Staatliche Realschule Abensberg Stadionstraße 46 93326  Abensberg  09443/9143-0,12,13 09443/914330 Realschulen www.rs-abensberg.de
But i need to separate the data: with commas or someting like that!
And i have a second script. This part can do the CSV-formate. i want to ombine it with the spider-logic. But first lets have a look at the first script: with the great spider-logic.
see the code that is appropiate:
#!/usr/bin/perl
use strict;
use warnings;
use HTML::TableExtract;
use LWP::Simple;
use Cwd;
use POSIX qw(strftime);
my $te = HTML::TableExtract->new;
my $total_records = 0;
my $suchbegriffe = "e";
my $treffer = 50;
my $range = 0;
my $url_to_process = "http://192.68.214.70/km/asps/schulsuche.asp?q=";
my $processdir = "processing";
my $counter = 50;
my $displaydate = "";
my $percent = 0;
&workDir();
chdir $processdir;
&processURL();
print "\nPress <enter> to continue\n";
<>;
$displaydate = strftime('%Y%m%d%H%M%S', localtime);
open OUTFILE, ">webdata_for_$suchbegriffe\_$displaydate.txt";
&processData();
close OUTFILE;
print "Finished processing $total_records records...\n";
print "Processed data saved to $ENV{HOME}/$processdir/webdata_for_$suchbegriffe\_$displaydate.txt\n";
unlink 'processing.html';
die "\n";
sub processURL() {
print "\nProcessing $url_to_process$suchbegriffe&a=$treffer&s=$range\n";
getstore("$url_to_process$suchbegriffe&a=$treffer&s=$range", 'tempfile.html') or die 'Unable to get page';
while( <tempfile.html> ) {
open( FH, "$_" ) or die;
while( <FH> ) {
if( $_ =~ /^.*?(Treffer <b>)(d+)( - )(d+)(</b> w+ w+ <b>)(d+).*/ ) {
$total_records = $6;
print "Total records to process is $total_records\n";
}
}
close FH;
}
unlink 'tempfile.html';
}
sub processData() {
while ( $range <= $total_records) {
getstore("$url_to_process$suchbegriffe&a=$treffer&s=$range", 'processing.html') or die 'Unable to get page';
$te->parse_file('processing.html');
my ($table) = $te->tables;
for my $row ( $table->rows ) {
cleanup(#$row);
print OUTFILE "#$row\n";
}
$| = 1;
print "Processed records $range to $counter";
print "\r";
$counter = $counter + 50;
$range = $range + 50;
$te = HTML::TableExtract->new;
}
}
sub cleanup() {
for ( #_ ) {
s/s+/ /g;
}
}
sub workDir() {
# Use home directory to process data
chdir or die "$!";
if ( ! -d $processdir ) {
mkdir ("$ENV{HOME}/$processdir", 0755) or die "Cannot make directory $processdir: $!";
}
}
But as this-above script-unfortunatley does not take care for the separators i have had to take care for a method, that does look for separators. In order to get the data (output) separated.
So with the separation i am able to work with the data - and store it in a mysql-table.. or do something else...So here [below] are the bits - that work out the csv-formate Note - i want to put the code below into the code above - to combine the spider-logic of the above mentioned code with the logic of outputting the data in CSV-formate.
where to set in the code Question: can we identify this point to migrate the one into the other... !?
That would be amazing... I hope i could make clear what i have in mind...!? Are we able to use the benefits of the both parts (/scripts ) migrating them into one?
So the question is: where to set in with the CSV-Script into the script (above)
#!/usr/bin/perl
use warnings;
use strict;
use LWP::Simple;
use HTML::TableExtract;
use Text::CSV;
my $html= get 'http://192.68.214.70/km/asps/schulsuche.asp?q=a&a=20';
$html =~ tr/\r//d; # strip carriage returns
$html =~ s/ / /g; # expand spaces
my $te = new HTML::TableExtract();
$te->parse($html);
my #cols = qw(
rownum
number
name
phone
type
website
);
my #fields = qw(
rownum
number
name
street
postal
town
phone
fax
type
website
);
my $csv = Text::CSV->new({ binary => 1 });
foreach my $ts ($te->table_states) {
foreach my $row ($ts->rows) {
# trim leading/trailing whitespace from base fields
s/^\s+//, s/\s+$// for #$row;
# load the fields into the hash using a "hash slice"
my %h;
#h{#cols} = #$row;
# derive some fields from base fields, again using a hash slice
#h{qw/name street postal town/} = split /\n+/, $h{name};
#h{qw/phone fax/} = split /\n+/, $h{phone};
# trim leading/trailing whitespace from derived fields
s/^\s+//, s/\s+$// for #h{qw/name street postal town/};
$csv->combine(#h{#fields});
print $csv->string, "\n";
}
}
The thing is that i have had very good results with the first script! It fetches the data from the page: http://192.68.214.70/km/asps/schulsuche.asp?q=n&a=20
(note 6142 records) - But note - the data are not separated...!
And i have a second script. This part can do the CSV-formate. i want to combine it with the spider-logic.
where is the part to insert? I look forward to any and all help.
if i have to be more precice - just let me know...
Since you have entered a complete script, I'll assume you want critique of the whole thing.
#!/usr/bin/perl
use strict;
use warnings;
use HTML::TableExtract;
use LWP::Simple;
use Cwd;
use POSIX qw(strftime);
my $te = HTML::TableExtract->new;
Since you only use $te in one block, why are you declaring and initializing it in this outer scope? The same question applies to most of your variables -- try to declare them in the innermost scope possible.
my $total_records = 0;
my $suchbegriffe = "e";
my $treffer = 50;
In general, english variable names will enable you to collaborate with far more people than german names. I understand german, so I understand the intent of your code, but most of SO doesn't.
my $range = 0;
my $url_to_process = "http://192.68.214.70/km/asps/schulsuche.asp?q=";
my $processdir = "processing";
my $counter = 50;
my $displaydate = "";
my $percent = 0;
&workDir();
Don't use & to call subs. Just call them with workDir;. It hasn't been necessary to use & since 1994, and it can lead to a nasty gotcha because &callMySub; is a special case which doesn't do what you might think, while callMySub; does the Right Thing.
chdir $processdir;
&processURL();
print "\nPress <enter> to continue\n";
<>;
$displaydate = strftime('%Y%m%d%H%M%S', localtime);
open OUTFILE, ">webdata_for_$suchbegriffe\_$displaydate.txt";
Generally lexical filehandles are preferred these days: open my $outfile, ">file"; Also, you should check for errors from open or use autodie; to make open die on failure.
&processData();
close OUTFILE;
print "Finished processing $total_records records...\n";
print "Processed data saved to $ENV{HOME}/$processdir/webdata_for_$suchbegriffe\_$displaydate.txt\n";
unlink 'processing.html';
die "\n";
sub processURL() {
print "\nProcessing $url_to_process$suchbegriffe&a=$treffer&s=$range\n";
getstore("$url_to_process$suchbegriffe&a=$treffer&s=$range", 'tempfile.html') or die 'Unable to get page';
while( <tempfile.html> ) {
open( FH, "$_" ) or die;
while( <FH> ) {
if( $_ =~ /^.*?(Treffer <b>)(d+)( - )(d+)(</b> w+ w+ <b>)(d+).*/ ) {
$total_records = $6;
print "Total records to process is $total_records\n";
}
}
close FH;
}
unlink 'tempfile.html';
}
sub processData() {
while ( $range <= $total_records) {
getstore("$url_to_process$suchbegriffe&a=$treffer&s=$range", 'processing.html') or die 'Unable to get page';
$te->parse_file('processing.html');
my ($table) = $te->tables;
for my $row ( $table->rows ) {
cleanup(#$row);
print OUTFILE "#$row\n";
This is the line to change if you want to put commas in separating your data. Look at the join function, it can do what you want.
}
$| = 1;
print "Processed records $range to $counter";
print "\r";
$counter = $counter + 50;
$range = $range + 50;
$te = HTML::TableExtract->new;
}
It's very strange to initialize $te at the end of the loop instead of the beginning. It's much more idiomatic to declare and initialize $te at the top of the loop.
}
sub cleanup() {
for ( #_ ) {
s/s+/ /g;
Did you mean s/\s+/ /g;?
}
}
sub workDir() {
# Use home directory to process data
chdir or die "$!";
if ( ! -d $processdir ) {
mkdir ("$ENV{HOME}/$processdir", 0755) or die "Cannot make directory $processdir: $!";
}
}
I haven't commented on your second script; perhaps you should ask it as a separate question.