I'm trouble understanding the output of the below code.
1. Why is the output Jo Al Ch and Sa? Doesn't chop remove the last character of string and return that character, so shouldn't the output be n i n and y? 2. What is the purpose of the $firstline=0; line in the code?
3. What exactly is happening at the lines
foreach(#data)
{$name,$age)=split(//,$_);
print "$name $age \n";
The output of the following code is
Data in file is:
J o
A l
C h
S a
The file contents are:
NAME AGE
John 26
Ali 21
Chen 22
Sally 25
The code:
#!/usr/bin/perl
my ($firstline,
#data,
$data);
open (INFILE,"heading.txt") or die $.;
while (<INFILE>)
{
if ($firstline)
{
$firstline=0;
}
else
{
chop(#data=<INFILE>);
}
print "Data in file is: \n";
foreach (#data)
{
($name,$age)=split(//,$_);
print "$name $age\n";
}
}
There are few issues with this script but first I will answer your points
chop will remove the last character of a string and returns the character chopped. In your data file "heading.txt" every line might be ending with \n and hence chop will be removing \n. It is always recommended to use chomp instead.
You can verify what is the last character of the line by running the command below:
od -bc heading.txt
0000000 116 101 115 105 040 101 107 105 012 112 157 150 156 040 062 066
N A M E A G E \n J o h n 2 6
0000020 012 101 154 151 040 062 061 012 103 150 145 156 040 062 062 012
\n A l i 2 1 \n C h e n 2 2 \n
0000040 123 141 154 154 171 040 062 065 012
S a l l y 2 5 \n
0000051
You can see \n
There is no use of $firstline because it is never been set to 1. So you can remove the if/else block.
In the first line it is reading all the elements of array #data one by one. In 2nd line it is splitting the contents of the element in characters and capturing first 2 characters and assigning them to $name and $age variables and discarding the rest. In the last line we are printing those captured characters.
IMO, in line 2 we should do split based on space to actual capture the name and age.
So the final script should looks like:
#!/usr/bin/perl
use strict;
use warnings;
my #data;
open (INFILE,"heading.txt") or die "Can't open heading.txt: $!";
while (<INFILE>) {
chomp(#data= <INFILE>);
}
close(INFILE);
print "Data in file is: \n";
foreach (#data) {
my ($name,$age)=split(/ /,$_);
print "$name $age\n";
}
Output:
Data in file is:
John 26
Ali 21
Chen 22
Sally 25
Related
I asked this type of ques previously but didn't provide the full code.
I am reading below file and checking the max word width present in each column and then write it to another file with proper alignment.
id0 id1 id2 batch
0 34 56 70
2 3647 58 72 566
4 39 616 75 98 78 78987 9876 7899 776
89 40 62 76
8 42 64 78
34 455 544 565
My code:
unlink "temp1.log";
use warnings;
use strict;
use feature 'say';
my $log1_file = "log1.log";
my $temp1 = "temp1.log";
open(IN1, "<$log1_file" ) or die "Could not open file $log1_file: $!";
my #col_lens;
while (my $line = <IN1>) {
my #fs = split " ", $line;
my #rows = #fs ;
#col_lens = map (length, #rows) if $.==1;
for my $col_idx (0..$#rows) {
my $col_len = length $rows[$col_idx];
if ($col_lens[$col_idx] < $col_len) {
$col_lens[$col_idx] = $col_len;
}
};
};
close IN1;
open(IN1, "<$log1_file" ) or die "Could not open file $log1_file: $!";
open(tempp1,"+>>$temp1") or die "Could not open file $temp1: $!";
while (my $line = <IN1>) {
my #fs = split " ", $line;
my #az;
for my $h (0..$#fs) {
my $len = length $fs[$h];
my $blk_len = $col_lens[$h]+1;
my $right = $blk_len - $len;
$az[$h] = (" ") . $fs[$h] . ( " " x $right );
}
say tempp1 (join "|",#az);
};
My warning
Use of uninitialized value in numeric lt (<) at new.pl line 25, <IN1> line 3.
Use of uninitialized value in numeric lt (<) at new.pl line 25, <IN1> line 4.
Use of uninitialized value in numeric lt (<) at new.pl line 25, <IN1> line 4.
Use of uninitialized value in numeric lt (<) at new.pl line 25, <IN1> line 4.
Use of uninitialized value in numeric lt (<) at new.pl line 25, <IN1> line 4.
Use of uninitialized value in numeric lt (<) at new.pl line 25, <IN1> line 4.
I am getting the output correctly but don't know how to remove this warnings.
$col_idx can be up to the number of fields on a line, minus one. For the third line, this is more than the highest index of #col_lens, which contains at most 3 elements. So doing the following makes no sense:
if ($col_lens[$col_idx] < $col_len) {
$col_lens[$col_idx] = $col_len;
}
Replace it with
if (!defined($col_lens[$col_idx]) || $col_lens[$col_idx] < $col_len) {
$col_lens[$col_idx] = $col_len;
}
With this, there's really no point checking for $. == 1 anymore.
You're getting uninitialized warning because, while checking the $col_lens[$col_idx] < $col_len condition, one or both of them are undef.
Solution 1:
You can skip checking this condition by the use of next statement.
for my $col_idx (0..$#rows) {
my $col_len = length $rows[$col_idx];
next unless $col_lens[$col_idx];
if ($col_lens[$col_idx] < $col_len) {
$col_lens[$col_idx] = $col_len;
}
}
Solution 2: (Not advised):
You can simply ignore Use of uninitialized value.. warnings by putting this line at top of your script. This will disable uninitialized warnings in a block.
no warnings 'uninitialized';
For more info, please refer this link
Following code demonstrates one of many possible ways for solution to this task
read line by line
get length of each field
compare with stored earlier
adjust to max length
form $format string for print
print formatted data
use strict;
use warnings;
use feature 'say';
my(#data,#length,$format);
while ( <DATA> ) {
my #e = split ' ';
my #l = map{ length } #e;
$length[$_] = ($length[$_] // 0) < $l[$_] ? $l[$_] : $length[$_] for 0..$#e;
push #data,\#e;
}
$format = join ' ', map{ '%'.$_.'s' } #length;
$format .= "\n";
for my $row ( #data ) {
printf $format, map { $row->[$_] // '' } 0..$#length;;
}
__DATA__
id0 id1 id2 batch
0 34 56 70
2 3647 58 72 566
4 39 616 75 98 78 78987 9876 7899 776
89 40 62 76
8 42 64 78
34 455 544 565
Output
id0 id1 id2 batch
0 34 56 70
2 3647 58 72 566
4 39 616 75 98 78 78987 9876 7899 776
89 40 62 76
8 42 64 78
34 455 544 565
What's the best way to generate all combinations of 1 to N digits, where digits could be repeated in the combination? E.g, given array 0..2, the result should be:
0
1
2
00
01
02
10
11
12
20
21
22
000
001
002
010
011
etc.
I've played with Algorithm::Permute, but it looks likt it could generate just unique combinations of N numbers:
for( my $a = 0; $a < 3; $a++ ) {
for( my $b = 0; $b < 3; $b++ ) {
my #array = $a..$b;
Algorithm::Permute::permute {
my $Num = join("", #array);
print $Num;
sleep 1;
} #array;
}
}
Thank you.
As its name suggests,
Algorithm::Permute
offers permutations. There are many mathematical variations on selecting k items from a population of N: with and without replacement, with and without repetition, ignoring order or not
It's hard to be certain, but you probably want
Algorithm::Combinatorics
Here's some example code that reproduces at least the part of your expected data that you have shown. It's pretty much the same as zdim's solution but there may be something extra useful to you here
use strict;
use warnings 'all';
use feature 'say';
use Algorithm::Combinatorics 'variations_with_repetition';
my #data = 0 .. 2;
for my $k ( 1 .. #data ) {
say #$_ for variations_with_repetition(\#data, $k);
}
output
0
1
2
00
01
02
10
11
12
20
21
22
000
001
002
010
011
012
020
021
022
100
101
102
110
111
112
120
121
122
200
201
202
210
211
212
220
221
222
my #digits = 0..2;
my $len = 3;
my #combinations = map glob("{#{[join ',', #digits]}}" x $_), 1..$len;
I want to first apologize for the biological nature of this post. I thought I should post some background first. I have a set of gene files that contain anywhere from one to five DNA sequences from different species. I used a bash shell script to perform blastn with each gene file as a query and a file of all transcriptome sequences (all_transcriptome_seq.fasta) from the five species as the subject. I now want to process these output files (and there are many) so that I can get all subject sequences that hit into one file per gene, with duplicate sequences removed (except to keep one), and ensure I'm getting the length of the sequences that actually hit the query.
Here is what the blastn output looks like for one gene file (columns: qseqid qlen sseqid slen qframe qstart qend sframe sstart send evalue bitscore pident nident length)
Acur_01000750.1_OFAS014956-RA-EXON04 248 Apil_comp17195_c0_seq1 1184 1 1 248 1 824 1072 2e-73 259 85.60 214 250
Acur_01000750.1_OFAS014956-RA-EXON04 248 Atri_comp5613_c0_seq1 1067 1 2 248 1 344 96 8e-97 337 91.16 227 249
Acur_01000750.1_OFAS014956-RA-EXON04 248 Acur_01000750.1 992 1 1 248 1 655 902 1e-133 459 100.00 248 248
Acur_01000750.1_OFAS014956-RA-EXON04 248 Btri_comp17734_c0_seq1 1001 1 1 248 1 656 905 5e-69 244 84.40 211 250
Btri_comp17734_c0_seq1_OFAS014956-RA-EXON04 250 Atri_comp5613_c0_seq1 1067 1 2 250 1 344 96 1e-60 217 82.33 205 249
Btri_comp17734_c0_seq1_OFAS014956-RA-EXON04 250 Acur_01000750.1 992 1 1 250 1 655 902 5e-69 244 84.40 211 250
Btri_comp17734_c0_seq1_OFAS014956-RA-EXON04 250 Btri_comp17734_c0_seq1 1001 1 1 250 1 656 905 1e-134 462 100.00 250 250
I've been working on a perl script that would, in short, take the sseqid column to pull out the corresponding sequences from the all_transcriptome_seq.fasta file, place these into a new file, and trim the transcripts to the sstart and send positions. Here is the script, so far:
#!/usr/bin/env perl
use warnings;
use strict;
use Data::Dumper;
############################################################################
# blastn_post-processing.pl v. 1.0 by Michael F., XXXXXX
############################################################################
my($progname) = $0;
############################################################################
# Initialize variables
############################################################################
my($jter);
my($com);
my($t1);
if ( #ARGV != 2 ) {
print "Usage:\n \$ $progname <infile> <transcriptomes>\n";
print " infile = tab-delimited blastn text file\n";
print " transcriptomes = fasta file of all transcriptomes\n";
print "exiting...\n";
exit;
}
my($infile)=$ARGV[0];
my($transcriptomes)=$ARGV[1];
############################################################################
# Read the input file
############################################################################
print "Reading the input file... ";
open (my $INF, $infile) or die "Unable to open file";
my #data = <$INF>;
print #data;
close($INF) or die "Could not close file $infile.\n";
my($nlines) = $#data + 1;
my($inlines) = $nlines - 1;
print "$nlines blastn hits read\n\n";
############################################################################
# Extract hits and place sequences into new file
############################################################################
my #temparray;
my #templine;
my($seqfname);
open ($INF, $infile) or die "Could not open file $infile for input.\n";
#temparray = <$INF>;
close($INF) or die "Could not close file $infile.\n";
$t1 = $#temparray + 1;
print "$infile\t$t1\n";
$seqfname = "$infile" . ".fasta";
if ( -e $seqfname ) {
print " --> $seqfname exists. overwriting\n";
unlink($seqfname);
}
# iterate through the individual hits
for ($jter=0; $jter<$t1; $jter++) {
(#templine) = split(/\s+/, $temparray[$jter]);
$com = "./extract_from_genome2 $transcriptomes $templine[2] $templine[8] $templine[9] $templine[2]";
# print "$com\n";
system("$com");
system("cat temp.3 >> $seqfname");
} # end for ($jter=0; $jter<$t1...
# Arguments for "extract_from_genome2"
# // argv[1] = name of genome file
# // argv[2] = gi number for contig
# // argv[3] = start of subsequence
# // argv[4] = end of subsequence
# // argv[5] = name of output sequence
Using this script, here is the output I'm getting:
>Apil_comp17195_c0_seq1
GATTCTTGCATCTGCAGTAAGACCAGAAATGCTCATTCCTATATGGCTATCTAATGGTATTATTTTTTTCTGATGTGCTGATAATTCAGACGAAGCTCTTTTAAGAGCCACAAGAACTGCATACTGCTTGTTTTTTACTCCAACAGTAGCAGCTCCCAGTTTTACAGCTTCCATTGCATATTCGACTTGGTGCAGGCGTCCCTGGGGACTCCAGACGGTAACGTCAGAATCATACTGGTTACGGAACA
>Atri_comp5613_c0_seq1
GAGAATTCTAGCATCAGCAGTGAGGCCTGAAATACTCATGCCTATGTGACTATCTAGAGGTATTATTTTTTTTTGATGAGCTGACAGTTCAGAAGAAGCTCTTTTGAGAGCTACAAGAACTGCATACTGTTTATTTTTTACTCCAACTGTTGCTGCTCCAAGCTTTACAGCCTCCATTGCATATTCCACTTGGTGTAAACGCCCCTGAGGACTCCATACCGTAACATCAGAATCATACTGATTACGGA
>Acur_01000750.1
GAATTCTAGCGTCAGCAGTGAGTCCTGAAATACTCATCCCTATGTGGCTATCTAGAGGTATTATTTTTTCTGATGGGCCGACAGTTCAGAGGATGCTCTTTTAAGAGCCACAAGAACTGCATACTCTTTATTTTTACTCCAACAGTAGCAGCTCCAAGCTTCACAGCCTCCATTGCATATTCCACCTGGTGTAAACGTCCCTGAGGGCTCCATACCGTAACATCAGAATCATACTGGTTACGGAACA
>Btri_comp17734_c0_seq1
GAATCCTTGCATCTGCAGTAAGTCCAGAAATGCTCATTCCAATATGGCTATCTAATGGTATTATTTTTTTCTGGTGAGCAGACAATTCAGATGATGCTCTTTTAAGAGCTACCAGTACTGCAAAATCATTGTTCTTCACTCCAACAGTTGCAGCACCTAATTTGACTGCCTCCATTGCATACTCCACTTGGTGCAATCTTCCCTGAGGGCTCCATACCGTAACATCAGAATCATACTGGTTACGGAACA
>Atri_comp5613_c0_seq1
GAGAATTCTAGCATCAGCAGTGAGGCCTGAAATACTCATGCCTATGTGACTATCTAGAGGTATTATTTTTTTTTGATGAGCTGACAGTTCAGAAGAAGCTCTTTTGAGAGCTACAAGAACTGCATACTGTTTATTTTTTACTCCAACTGTTGCTGCTCCAAGCTTTACAGCCTCCATTGCATATTCCACTTGGTGTAAACGCCCCTGAGGACTCCATACCGTAACATCAGAATCATACTGATTACGGA
>Acur_01000750.1
GAATTCTAGCGTCAGCAGTGAGTCCTGAAATACTCATCCCTATGTGGCTATCTAGAGGTATTATTTTTTCTGATGGGCCGACAGTTCAGAGGATGCTCTTTTAAGAGCCACAAGAACTGCATACTCTTTATTTTTACTCCAACAGTAGCAGCTCCAAGCTTCACAGCCTCCATTGCATATTCCACCTGGTGTAAACGTCCCTGAGGGCTCCATACCGTAACATCAGAATCATACTGGTTACGGAACA
>Btri_comp17734_c0_seq1
GAATCCTTGCATCTGCAGTAAGTCCAGAAATGCTCATTCCAATATGGCTATCTAATGGTATTATTTTTTTCTGGTGAGCAGACAATTCAGATGATGCTCTTTTAAGAGCTACCAGTACTGCAAAATCATTGTTCTTCACTCCAACAGTTGCAGCACCTAATTTGACTGCCTCCATTGCATACTCCACTTGGTGCAATCTTCCCTGAGGGCTCCATACCGTAACATCAGAATCATACTGGTTACGGAACA
As you can see, it's pretty close to what I'm wanting. Here are the two issues I have and cannot seem to figure out how to resolve with my script. The first is that a sequence may occur more than once in the sseqid column, and with the script in its current form, it will print out duplicates of these sequences. I only need one. How can I modify my script to not duplicate sequences (i.e., how do I only retain one but remove the other duplicates)? Expected output:
>Apil_comp17195_c0_seq1
GATTCTTGCATCTGCAGTAAGACCAGAAATGCTCATTCCTATATGGCTATCTAATGGTATTATTTTTTTCTGATGTGCTGATAATTCAGACGAAGCTCTTTTAAGAGCCACAAGAACTGCATACTGCTTGTTTTTTACTCCAACAGTAGCAGCTCCCAGTTTTACAGCTTCCATTGCATATTCGACTTGGTGCAGGCGTCCCTGGGGACTCCAGACGGTAACGTCAGAATCATACTGGTTACGGAACA
>Atri_comp5613_c0_seq1
GAGAATTCTAGCATCAGCAGTGAGGCCTGAAATACTCATGCCTATGTGACTATCTAGAGGTATTATTTTTTTTTGATGAGCTGACAGTTCAGAAGAAGCTCTTTTGAGAGCTACAAGAACTGCATACTGTTTATTTTTTACTCCAACTGTTGCTGCTCCAAGCTTTACAGCCTCCATTGCATATTCCACTTGGTGTAAACGCCCCTGAGGACTCCATACCGTAACATCAGAATCATACTGATTACGGA
>Acur_01000750.1
GAATTCTAGCGTCAGCAGTGAGTCCTGAAATACTCATCCCTATGTGGCTATCTAGAGGTATTATTTTTTCTGATGGGCCGACAGTTCAGAGGATGCTCTTTTAAGAGCCACAAGAACTGCATACTCTTTATTTTTACTCCAACAGTAGCAGCTCCAAGCTTCACAGCCTCCATTGCATATTCCACCTGGTGTAAACGTCCCTGAGGGCTCCATACCGTAACATCAGAATCATACTGGTTACGGAACA
>Btri_comp17734_c0_seq1
GAATCCTTGCATCTGCAGTAAGTCCAGAAATGCTCATTCCAATATGGCTATCTAATGGTATTATTTTTTTCTGGTGAGCAGACAATTCAGATGATGCTCTTTTAAGAGCTACCAGTACTGCAAAATCATTGTTCTTCACTCCAACAGTTGCAGCACCTAATTTGACTGCCTCCATTGCATACTCCACTTGGTGCAATCTTCCCTGAGGGCTCCATACCGTAACATCAGAATCATACTGGTTACGGAACA
The second is the script is not quite extracting the right base pairs. It's super close, off by one or two, but its not exact.
For example, take the first subject hit Apil_comp17195_c0_seq1. The sstart and send values are 824 and 1072, respectively. When I go to the all_transcriptome_seq.fasta, I get
AAGATTCTTGCATCTGCAGTAAGACCAGAAATGCTCATTCCTATATGGCTATCTAATGGTATTATTTTTTTCTGATGTGCTGATAATTCAGACGAAGCTCTTTTAAGAGCCACAAGAACTGCATACTGCTTGTTTTTTACTCCAACAGTAGCAGCTCCCAGTTTTACAGCTTCCATTGCATATTCGACTTGGTGCAGGCGTCCCTGGGGACTCCAGACGGTAACGTCAGAATCATACTGGTTACGGAAC
at that base pair range, not
GATTCTTGCATCTGCAGTAAGACCAGAAATGCTCATTCCTATATGGCTATCTAATGGTATTATTTTTTTCTGATGTGCTGATAATTCAGACGAAGCTCTTTTAAGAGCCACAAGAACTGCATACTGCTTGTTTTTTACTCCAACAGTAGCAGCTCCCAGTTTTACAGCTTCCATTGCATATTCGACTTGGTGCAGGCGTCCCTGGGGACTCCAGACGGTAACGTCAGAATCATACTGGTTACGGAACA
as outputted by my script, which is what I'm expecting. You will also notice that the sequence outputted by my script is slightly shorter than it should be. Does anyone know how I can fix these issues in my script?
Thanks, and sorry for the lengthy post!
Edit 1: a solution was offered that work for some of the infiles. However, some were causing the script to output fewer sequences than expected. Here is one such infile with 9 hits, from which I was expecting only 4 sequences.
Note: this issue has been largely resolved based on the solution provided below the answer section
Apil_comp16418_c0_seq1_OFAS000119-RA-EXON01 1587 Apil_comp16418_c0_seq1 2079 1 1 1587 1 416 2002 0.0 2931 100.00 1587 1587
Apil_comp16418_c0_seq1_OFAS000119-RA-EXON01 1587 Atri_comp13712_c0_seq1 1938 1 1 1587 1 1651 75 0.0 1221 80.73 1286 1593
Apil_comp16418_c0_seq1_OFAS000119-RA-EXON01 1587 Ctom_01003023.1 2162 1 1 1406 1 1403 1 0.0 1430 85.07 1197 1407
Atri_comp13712_c0_seq1_OFAS000119-RA-EXON01 1441 Apil_comp16418_c0_seq1 2079 1 1 1437 1 1866 430 0.0 1170 81.43 1175 1443
Atri_comp13712_c0_seq1_OFAS000119-RA-EXON01 1441 Atri_comp13712_c0_seq1 1938 1 1 1441 1 201 1641 0.0 2662 100.00 1441 1441
Atri_comp13712_c0_seq1_OFAS000119-RA-EXON01 1441 Acur_01000228.1 2415 1 1 1440 1 2231 797 0.0 1906 90.62 1305 1440
Ctom_01003023.1_OFAS000119-RA-EXON01 1289 Apil_comp16418_c0_seq1 2079 1 3 1284 1 1714 430 0.0 1351 85.69 1102 1286
Ctom_01003023.1_OFAS000119-RA-EXON01 1289 Acur_01000228.1 2415 1 1 1287 1 2084 797 0.0 1219 83.81 1082 1291
Ctom_01003023.1_OFAS000119-RA-EXON01 1289 Ctom_01003023.1 2162 1 1 1289 1 106 1394 0.0 2381 100.00 1289 1289
Edit 2: There is still an occasional output lacking fewer sequences than expected, although not as many after incorporating modifications to my script from Edit 1 suggestion (i.e., accounting for reverse direction). I cannot figure out why the script would be outputting fewer sequences in these other cases. Below the infile in question. The output is lacking Btri_comp15171_c0_seq1:
Apil_comp19456_c0_seq1_OFAS000248-RA-EXON07 2464 Apil_comp19456_c0_seq1 3549 1 1 2464 1 761 3224 0.0 4551 100.00 2464 2464
Apil_comp19456_c0_seq1_OFAS000248-RA-EXON07 2464 Btri_comp15171_c0_seq1 3766 1 1 2456 1 3046 591 0.0 1877 80.53 1985 2465
Btri_comp15171_c0_seq1_OFAS000248-RA-EXON07 2457 Apil_comp19456_c0_seq1 3549 1 1 2457 1 3214 758 0.0 1879 80.54 1986 2466
Btri_comp15171_c0_seq1_OFAS000248-RA-EXON07 2457 Atri_comp28646_c0_seq1 1403 1 1256 2454 1 1401 203 0.0 990 81.60 980 1201
Btri_comp15171_c0_seq1_OFAS000248-RA-EXON07 2457 Btri_comp15171_c0_seq1 3766 1 1 2457 1 593 3049 0.0 4538 100.00 2457 2457
You can use hash to remove duplicates
The bellow code remove duplicates depending on their subject length (keep larger subject length rows).
Just update your # iterate through the individual hits part with
# iterate through the individual hits
my %filterhash;
my $subject_length;
for ($jter=0; $jter<$t1; $jter++) {
(#templine) = split(/\s+/, $temparray[$jter]);
$subject_length = $templine[9] -$templine[8];
if(exists $filterhash{$templine[2]} ){
if($filterhash{$templine[2]} < $subject_length){
$filterhash{$templine[2]}= $subject_length;
}
}
else{
$filterhash{$templine[2]}= $subject_length;
}
}
my %printhash;
for ($jter=0; $jter<$t1; $jter++) {
(#templine) = split(/\s+/, $temparray[$jter]);
$subject_length = $templine[9] -$templine[8];
if(not exists $printhash{$templine[2]})
{
$printhash{$templine[2]}=1;
if(exists $filterhash{$templine[2]} and $filterhash{$templine[2]} == $subject_length ){
$com = "./extract_from_genome2 $transcriptomes $templine[2] $templine[8] $templine[9] $templine[2]";
# print "$com\n";
system("$com");
system("cat temp.3 >> $seqfname");
}
}
else{
if(exists $filterhash{$templine[2]} and $filterhash{$templine[2]} == $subject_length ){
$com = "./extract_from_genome2 $transcriptomes $templine[2] $templine[8] $templine[9] $templine[2]";
#print "$com\n";
system("$com");
system("cat temp.3 >> $seqfname");
}
}
} # end for ($jter=0; $jter<$t1...
Hope this will help you.
Edit part update
for negative stand you need to replace
$subject_length = $templine[9] -$templine[8];
with
if($templine[8] > $templine[9]){
$subject_length = $templine[8] -$templine[9];
}else{
$subject_length = $templine[9] -$templine[8];
}
You also need to update your extract_from_genome2 code for negative strand sequences.
I have a file with 3 columns ->
A1 0 9
A1 4 14
A1 16 24
A1 25 54
A1 64 84
A1 74 84
A2 15 20
A2 19 50
I want to check if each line (value in col2 and 3) is present already or is in between the range of previous line, if col1 value is equal.
The desired output is ->
A1 0 14
A1 16 54
A1 64 84
A2 15 50
I have tried ->
#ARGV or die "No input file specified";
open $first, '<',$ARGV[0] or die "Unable to open input file: $!";
#open $second,'<', $ARGV[1] or die "Unable to open input file: $!";
$k=0;
while (<$first>)
{
if($k==0)
{
#cols = split /\s+/;
$p0=$cols[0];
$p1=$cols[1];
$p2=$cols[2];
$p3=$cols[2]+1;
}
else{
#new = split /\s+/;
if ($new[0] eq $p0){
if ($new[1]>$p3)
{
print join("\t", #new),"\n";
$p0=$new[0];
$p1=$new[1];
$p2=$new[2];
$p3=$new[2]+1;
}
elsif ($new[2]>=$p2)
{
print $p0,"\t",$p1,"\t",$new[2],"\n";
$p2=$new[2];
$p3=$new[2]+1;
}
else
{
$p5=1;
}
}
else
{
print join("\t", #new),"\n";
$p0=$new[0];
$p1=$new[1];
$p2=$new[2];
$p3=$new[2]+1;
}}
$k=1;
}
and output I am getting is ->
A1 0 14
A1 16 24
A1 16 54
A1 64 84
A1 64 84
A2 15 20
A2 22 50
I am not able to understand why I am getting this wrong output. Also if there is any way that I can erase(or overwrite) the last printed line, then it will be very easy.
First of all, it would be much more simple to help you if you
used strict and warnings, and declared all your variabled close to first use with my
indented your code properly to show the structure
The reason your code fails is that you are printing data under too many conditions. For example you output A1 16 24 when you find it cannot be joined with the previous range A1 4 14 without waiting for it to be extended by the subsequent A1 25 54 (when you correctly extend the range and print it again). A1 64 84 is output twice for the same reason: first because it cannot be merged with A1 25 54, and again because it has been "extended" with A1 74 84. Finally A2 15 20 is output straight away because it has a new first column, even though it is merged with the next line and output again.
You need to output a range only when you have found that it cannot be extended again. That happens when
a new record is found that doesn't overlap the existing data
the end of the file is reached
This code prints output only in those cases an appears to do what you need.
use strict;
use warnings;
my #data;
while (<DATA>) {
if (not #data) {
#data = split;
next;
}
my #new = split;
if ($new[0] eq $data[0] and $new[1] <= $data[2] + 1) {
$data[2] = $new[2];
}
else {
print join("\t", #data), "\n";
#data = #new;
}
print join("\t", #data), "\n" if eof DATA;
}
__DATA__
A1 0 9
A1 4 14
A1 16 24
A1 25 54
A1 52 57
A1 59 62
A1 64 84
A1 74 84
A2 15 20
A2 19 50
OUTPUT
A1 0 14
A1 16 57
A1 59 62
A1 64 84
A2 15 50
You need to have some variables describing currently-accumulated contiguous region. For each line of input, flush the previously-accumulated region if the new input is a new column1 label, or is same label but non-contiguous, or is end-of-file. If it's same label and contiguous yo update the min and max values.
This assumes that columns 1 and 2 are sorted.
The rest is left as an exercise for the reader.
Name Mark1 Mark2 Mark3
Student 1 41 51 61
Student 2 42 52 62
Student 3 43 53 63
Student 4 44 54 64
Student 5 45 55 65
I when I give Name as input, I need to output the three Mark columns. How can I do this?
Assuming this is an array called #arr, where each entry is a line, and assuming the number of the student you're looking for is in $num, you can use:
foreach (#arr) {
if (/^Student \b$num\b\s+(\d.*\d)/) {
print "$2\n";
}
}
This iterates over all the entries in the array. It looks for lines that:
begin with "Student"
are followed by the exact number $num (the \bs around it specify word boundaries, so this can't be part of another number)
are followed by some whitespace
have a pattern beginning and ending with a number that is as long as possible.
If so, the pattern beginning and ending with a number is captured and printed. In this case, it corresponds exactly to Mark1, Mark2 & Mark3.
#!/usr/bin/perl
use warnings;
use strict;
my %hash = ();
print "Student No:"; #Eg:Student 1
chomp ( my $input = <>);
while (<DATA>) {
next if /^Name/;
chomp;
my ($student, $no, #marks) = split;
$hash{ "$student " . "$no" } = \#marks;
}
print join " ", #{$hash{ "$input" }};
__DATA__
Name Mark1 Mark2 Mark3
Student 1 41 51 61
Student 2 42 52 62
Student 3 43 53 63
Student 4 44 54 64
Student 5 45 55 65