Perl: Read columns and convert to array - perl

I am new to perl, trying to read a file with columns and creating an array.
I am having a file with following columns.
file.txt
A 15
A 20
A 33
B 20
B 45
C 32
C 78
I wanted to create an array for each unique item present in A with its values assigned from second column.
eg:
#A = (15,20,33)
#B = (20,45)
#C = (32,78)
Tried following code, only for printing 2 columns
use strict;
use warnings;
my $filename = $ARGV[0];
open(FILE, $filename) or die "Could not open file '$filename' $!";
my %seen;
while (<FILE>)
{
chomp;
my $line = $_;
my #elements = split (" ", $line);
my $row_name = join "\t", #elements[0,1];
print $row_name . "\n" if ! $seen{$row_name}++;
}
close FILE;
Thanks

Firstly some general Perl advice. These days, we like to use lexical variables as filehandles and pass three arguments to open().
open(my $fh, '<', $filename) or die "Could not open file '$filename' $!";
And then...
while (<$fh>) { ... }
But, given that you have your filename in $ARGV[0], another tip is to use an empty file input operator (<>) which will return data from the files named in #ARGV without you having to open them. So you can remove your open() line completely and replace the while with:
while (<>) { ... }
Second piece of advice - don't store this data in individual arrays. Far better to store it in a more complex data structure. I'd suggest a hash where the key is the letter and the value is an array containing all of the numbers matching that letter. This is surprisingly easy to build:
use strict;
use warnings;
use feature 'say';
my %data; # I'd give this a better name if I knew what your data was
while (<>) {
chomp;
my ($letter, $number) = split; # splits $_ on whitespace by default
push #{ $data{$letter} }, $number;
}
# Walk the hash to see what we've got
for (sort keys %data) {
say "$_ : #{ $data{$_ } }";
}

Change the loop to be something like:
while (my $line = <FILE>)
{
chomp($line);
my #elements = split (" ", $line);
push(#{$seen{$elements[0]}}, $elements[1]);
}
This will create/append a list of each item as it is found, and result in a hash where the keys are the left items, and the values are lists of the right items. You can then process or reassign the values as you wish.

Related

Parsing file based on column ID: perl

I have a tab delineated file with repeated values in the first column. The single, but repeated values in the first column correspond to multiple values in the second column. It looks something like this:
AAAAAAAAAA1 m081216|101|123
AAAAAAAAAA1 m081216|100|1987
AAAAAAAAAA1 m081216|927|463729
BBBBBBBBBB2 m081216|254|260489
BBBBBBBBBB2 m081216|475|1234
BBBBBBBBBB2 m081216|987|240
CCCCCCCCCC3 m081216|433|1000
CCCCCCCCCC3 m081216|902|366
CCCCCCCCCC3 m081216|724|193
For every type of sequence in the first column, I am trying to print to a file with just the sequences that correspond to it. The name of the file should include the repeated sequence in the first column and the number of sequences that correspond to it in the second column. In the above example I would therefore have 3 files of 3 sequences each. The first file would be named something like "AAAAAAAAAA1.3.txt" and look like the following when opened:
m081216|101|123
m081216|100|1987
m081216|927|463729
I have seen other similar questions, but they have been answered with using a hash. I don't think I can't use a hash because I need to keep the number of relationships between columns. Maybe there is a way to use a hash of hashes? I am not sure.
Here is my code so far.
use warnings;
use strict;
use List::MoreUtils 'true';
open(IN, "<", "/path/to/in_file") or die $!;
my #array;
my $queryID;
while(<IN>){
chomp;
my $OutputLine = $_;
processOutputLine($OutputLine);
}
sub processOutputLine {
my ($OutputLine) = #_;
my #Columns = split("\t", $OutputLine);
my ($queryID, $target) = #Columns;
push(#array, $target, "\n") unless grep{$queryID eq $_} #array;
my $delineator = "\n";
my $count = true { /$delineator/g } #array;
open(OUT, ">", "/path/to/out_$..$queryID.$count.txt") or die $!;
foreach(#array){
print OUT #array;
}
}
I would still recommend a hash. However, you store all sequences related to the same id in an anonymous array which is the value for that ID key. It's really two lines of code.
use warnings;
use strict;
use feature qw(say);
my $filename = 'rep_seqs.txt'; # input file name
open my $in_fh, '<', $filename or die "Can't open $filename: $!";
my %seqs;
foreach my $line (<$in_fh>) {
chomp $line;
my ($id, $seq) = split /\t/, $line;
push #{$seqs{$id}}, $seq;
}
close $in_fh;
my $out_fh;
for (sort keys %seqs) {
my $outfile = $_ . '_' . scalar #{$seqs{$_}} . '.txt';
open $out_fh, '>', $outfile or do {
warn "Can't open $outfile: $!";
next;
};
say $out_fh $_ for #{$seqs{$_}};
}
close $out_fh;
With your input I get the desired files, named AA..._count.txt, with their corresponding three lines each. If items separated by | should be split you can do that while writing it out, for example.
Comments
The anonymous array for a key $seqs{$id} is created once we push, if not there already
If there are issues with tabs (converted to spaces?), use ' '. See the comment.
A filehandle is closed and re-opened on every open, so no need to close every time
The default pattern for split is ' ', also triggering specific behavior -- it matches "any contiguous whitespace", and also omits leading whitespace. (The pattern / / matches a single space, turning off this special behavior of ' '.) See a more precise description on the split page. Thus it is advisable to use ' ' when splitting on unspecified number of spaces, since in the case of split this is a bit idiomatic, is perhaps the most common use, and is its default. Thanks to Borodin for prompting this comment and update (the original post had the equivalent /\s+/).
Note that in this case, since ' ' is the default along with $_, we can shorten it a little
for (<$in_fh>) {
chomp;
my ($id, $seq) = split;
push #{$seqs{$id}}, $seq;
}

Count the number of items derived from split without putting into an array

I am looking to spare the use of an array for memory's sake, but still get the number of items derived from the split function for each pass of a while loop.
The ultimate goal is to filter the output files according to the number of their sequences, which could either be deduced by the number of rows the file has, or the number of carrots that appear, or the number of line breaks, etc.
Below is my code:
#!/usr/bin/perl
use warnings;
use strict;
use diagnostics;
open(INFILE, "<", "Clustered_Barcodes.txt") or die $!;
my %hash = (
"TTTATGC" => "TATAGCGCTTTATGCTAGCTAGC",
"TTTATGG" => "TAGCTAGCTTTATGGGCTAGCTA",
"TTTATCC" => "GCTAGCTATTTATCCGCTAGCTA",
"TTTATCG" => "AGTCATGCTTTATCGCGATCGAT",
"TTTATAA" => "TAGCTAGCTTTATAATAGCTAGC",
"TTTATAA" => "ATCGATCGTTTATAACGATCGAT",
"TTTATAT" => "TCGATCGATTTATATTAGCTAGC",
"TTTATAT" => "TAGCTAGCTTTATATGCTAGCTA",
"TTTATTA" => "GCTAGCTATTTATTATAGCTAGC",
"CTTGTAA" => "ATCGATCGCTTGTAACGATTAGC",
);
while(my $line = <INFILE>){
chomp $line;
open my $out, '>', "Clustered_Barcode_$..txt" or die $!;
foreach my $sequence (split /\t/, $line){
if (exists $hash{$sequence}){
print $out ">$sequence\n$hash{$sequence}\n";
}
}
}
The input file, "Clustered_Barcodes.txt" when opened, looks like the following:
TTTATGC TTTATGG TTTATCC TTTATCG
TTTATAA TTTATAA TTTATAT TTTATAT TTTATTA
CTTGTAA
There will be three output files from the code, "Clustered_Barcode_1.txt", "Clustered_Barcode_2.txt", and "Clustered_Barcode_3.txt". An example of what the output files would look like could be the 3rd and final file, which would look like the following:
>CTTGTAA
ATCGATCGCTTGTAACGATTAGC
I need some way to modify my code to identify the number of rows, carrots, or sequences that appear in the file and work that into the title of the file. The new title for the above sequence could be something like "Clustered_Barcode_Number_3_1_Sequence.txt"
PS- I made the hash in the above code manually in attempt to make things simpler. If you want to see the original code, here it is. The input file format is something like:
>TAGCTAGC
GCTAAGCGATGCTACGGCTATTAGCTAGCCGGTA
Here is the code for setting up the hash:
my $dir = ("~/Documents/Sequences");
open(INFILE, "<", "~/Documents/Clustered_Barcodes.txt") or die $!;
my %hash = ();
my #ArrayofFiles = glob "$dir/*"; #put all files from the specified directory into an array
#print join("\n", #ArrayofFiles), "\n"; #this is a diagnostic test print statement
foreach my $file (#ArrayofFiles){ #make hash of barcodes and sequences
open (my $sequence, $file) or die "can't open file: $!";
while (my $line = <$sequence>) {
if ($line !~/^>/){
my $seq = $line;
$seq =~ s/\R//g;
#print $seq;
$seq =~ m/(CATCAT|TACTAC)([TAGC]{16})([TAGC]+)([TAGC]{16})(CATCAT|TACTAC)/;
$hash{$2} = $3;
}
}
}
while(<INFILE>){
etc
You can use regex to get the count:
my $delimiter = "\t";
my $line = "zyz pqr abc xyz";
my $count = () = $line =~ /$delimiter/g; # $count is now 3
print $count;
Your hash structure is not right for your problem as you have multiple entries for same ids. for example TTTATAA hash id has 2 entries in your %hash.
To solve this, use hash of array to create the hash.
Change your hash creation code in
$hash{$2} = $3;
to
push(#{$hash{$2}}, $3);
Now change your code in the while loop
while(my $line = <INFILE>){
chomp $line;
open my $out, '>', "Clustered_Barcode_$..txt" or die $!;
my %id_list;
foreach my $sequence (split /\t/, $line){
$id_list{$sequence}=1;
}
foreach my $sequence(keys %id_list)
{
foreach my $val (#{$hash{$sequence}})
{
print $out ">$sequence\n$val\n";
}
}
}
I have assummed that;
The first digit in the output file name is the input file line number
The second digit in the output file name is the input file column number
That the input hash is a hash of arrays to cover the case of several sequences "matching" the one barcode as mentioned in the comments
When a barcode has a match in the hash, that the output file will lists all the sequences in the array, one per line.
The simplest way to do this that I can see is to build the output file using a temporary filename and the rename it when you have all the data. According to the perl cookbook, the easiest way to create temporary files is with the module File::Temp.
The key to this solution is to move through the list of barcodes that appear on a line by column index rather than the usual perl way of simply iterating over the list itself. To get the actual barcodes, the column number $col is used to index back into #barcodes which is created by splitting the line on whitespace. (Note that splitting on a single space is special cased by perl to emulate the behaviour of one of its predecessors, awk (leading whitespace is removed and the split is on whitespace, not a single space)).
This way we have the column number (indexed from 1) and the line number we can get from the perl special variable, $. We can then use these to rename the file using the builtin, rename().
use warnings;
use strict;
use diagnostics;
use File::Temp qw(tempfile);
open(INFILE, "<", "Clustered_Barcodes.txt") or die $!;
my %hash = (
"TTTATGC" => [ "TATAGCGCTTTATGCTAGCTAGC" ],
"TTTATGG" => [ "TAGCTAGCTTTATGGGCTAGCTA" ],
"TTTATCC" => [ "GCTAGCTATTTATCCGCTAGCTA" ],
"TTTATCG" => [ "AGTCATGCTTTATCGCGATCGAT" ],
"TTTATAA" => [ "TAGCTAGCTTTATAATAGCTAGC", "ATCGATCGTTTATAACGATCGAT" ],
"TTTATAT" => [ "TCGATCGATTTATATTAGCTAGC", "TAGCTAGCTTTATATGCTAGCTA" ],
"TTTATTA" => [ "GCTAGCTATTTATTATAGCTAGC" ],
"CTTGTAA" => [ "ATCGATCGCTTGTAACGATTAGC" ]
);
my $cbn = "Clustered_Barcode_Number";
my $trailer = "Sequence.txt";
while (my $line = <INFILE>) {
chomp $line ;
my $line_num = $. ;
my #barcodes = split " ", $line ;
for my $col ( 1 .. #barcodes ) {
my $barcode = $barcodes[ $col - 1 ]; # arrays indexed from 0
# skip this one if its not in the hash
next unless exists $hash{$barcode} ;
my #sequences = #{ $hash{$barcode} } ;
# Have a hit - create temp file and output sequences
my ($out, $temp_filename) = tempfile();
say $out ">$barcode" ;
say $out $_ for (#sequences) ;
close $out ;
# Rename based on input line and column
my $new_name = join "_", $cbn, $line_num, $col, $trailer ;
rename ($temp_filename, $new_name) or
warn "Couldn't rename $temp_filename to $new_name: $!\n" ;
}
}
close INFILE
All of the barcodes in your sample input data have a match in the hash, so when I run this, I get 4 files for line 1, 5 for line 2 and 1 for line 3.
Clustered_Barcode_Number_1_1_Sequence.txt
Clustered_Barcode_Number_1_2_Sequence.txt
Clustered_Barcode_Number_1_3_Sequence.txt
Clustered_Barcode_Number_1_4_Sequence.txt
Clustered_Barcode_Number_2_1_Sequence.txt
Clustered_Barcode_Number_2_2_Sequence.txt
Clustered_Barcode_Number_2_3_Sequence.txt
Clustered_Barcode_Number_2_4_Sequence.txt
Clustered_Barcode_Number_2_5_Sequence.txt
Clustered_Barcode_Number_3_1_Sequence.txt
Clustered_Barcode_Number_1_2_Sequence.txt for example has:
>TTTATGG
TAGCTAGCTTTATGGGCTAGCTA
and Clustered_Barcode_Number_2_5_Sequence.txt has:
>TTTATTA
GCTAGCTATTTATTATAGCTAGC
Clustered_Barcode_Number_2_3_Sequence.txt - which matched a hash key with two sequences - had the following;
>TTTATAT
TCGATCGATTTATATTAGCTAGC
TAGCTAGCTTTATATGCTAGCTA
I was speculating here about what you wanted when a supplied barcode had two matches. Hope that helps.

How to find lines containing a match between two files in perl?

I'm a novice at using perl. What I want to do is compare two files. One is my index file that I am calling "temp." I am attempting to use this to search through a main file that I am calling "array." The index file has only numbers in it. There are lines in my array that have those numbers. I've been trying to find the intersection between those two files, but my code is not working. Here's what I've been trying to do.
#!/usr/bin/perl
print "Enter the input file:";
my $filename=<STDIN>;
open (FILE, "$filename") || die "Cannot open file: $!";
my #array=<FILE>;
close(FILE);
print "Enter the index file:";
my $temp=<STDIN>;
open (TEMP, "$temp") || die "Cannot open file: $!";
my #temp=<TEMP>;
close(TEMP);
my %seen= ();
foreach (#array) {
$seen{$_}=1;
}
my #intersection=grep($seen{$_}, #temp);
foreach (#intersection) {
print "$_\n";
}
If I can't use intersection, then what else can I do to move each line that has a match between the two files?
For those of you asking for the main file and the index file:
Main file:
1 CP TRT
...
14 C1 MPE
15 C2 MPE
...
20 CA1 MPE
Index file
20
24
22
17
18
...
I want to put those lines that contain one of the numbers in my index file into a new array. So using this example, only
20 CA1 MPE would be placed into a new array.
My main file and index file are both longer than what I've shown, but that hopefully gives you an idea on what I'm trying to do.
I am assuming something like this?
use strict;
use warnings;
use Data::Dumper;
# creating arrays instead of reading from file just for demo
# based on the assumption that your files are 1 number per line
# and no need for any particular parsing
my #array = qw/1 2 3 20 60 50 4 5 6 7/;
my #index = qw/10 12 5 3 2/;
my #intersection = ();
my %hash1 = map{$_ => 1} #array;
foreach (#index)
{
if (defined $hash1{$_})
{
push #intersection, $_;
}
}
print Dumper(\#intersection);
==== Out ====
$VAR1 = [
'5',
'3',
'2'
];
A few things:
Always have use strict; and use warnings; in your program. This will catch a lot of possible errors.
Always chomp after reading input. Perl automatically adds \n to the end of lines read. chomp removes the \n.
Learn a more modern form of Perl.
Use nemonic variable names. $temp doesn't cut it.
Use spaces to help make your code more readable.
You never stated the errors you were getting. I assume it has to do with the fact that the input from your main file doesn't match your index file.
I use a hash to create an index that the index file can use via my ($index) = split /\s+/, $line;:
#! /usr/bin/env perl
#
use strict;
use warnings;
use autodie;
use feature qw(say);
print "Input file name: ";
my $input_file = <STDIN>;
chomp $input_file; # Chomp Input!
print "Index file name: ";
my $index_file = <STDIN>;
chomp $index_file; # Chomp Input!
open my $input_fh, "<", $input_file;
my %hash;
while ( my $line = <$input_fh> ) {
chomp $line;
#
# Using split to find the item to index on
#
my ($index) = split /\s+/, $line;
$hash{$index} = $line;
}
close $input_fh;
open my $index_fh, "<", $index_file;
while ( my $index = <$index_fh> ) {
chomp $index;
#
# Now index can look up lines
#
if( exists $hash{$index} ) {
say qq(Index: $index Line: "$hash{$index}");
}
else {
say qq(Index "$index" doesn't exist in file.);
}
}
#!/usr/bin/perl
use strict;
use warnings;
use autodie;
#ARGV = 'main_file';
open(my $fh_idx, '<', 'index_file');
chomp(my #idx = <$fh_idx>);
close($fh_idx);
while (defined(my $r = <>)) {
print $r if grep { $r =~ /^[ \t]*$_/ } #idx;
}
You may wish to replace those hardcoded file names for <STDIN>.
FYI: The defined call inside a while condition might be "optional".

perl to loop and check across files

still having trouble with perl programming and I need to be pushed to make a script work out.
I have two files and I want to use the list file to "extract" rows from the data one. The problem is that the list file is formatted as follow:
X1 A B
X2 C D
X3 E F
And my data looks like this:
A X1 2 5
B X1 3 7
C X2 1 4
D X2 1 5
I need to obtain the element pairs from the list file by which select the row in the data file. At the same time I would like to write an output like this:
X1 A B 2 5 3 7
X2 C D 1 4 1 5
I'm trying writing a perl code, but I'm not able to produce something useful. I'm at this point:
open (LIST, "< $fils_list") || die "impossibile open the list";
#list = <LIST>;
close (LIST);
open (HAN, "< $data") || die "Impossible open data";
#r = <HAN>;
close (HAN);
for ($p=0; $p<=$#list; $p++){
chomp ($list[$p]);
($x, $id1, $id2) = split (/\t/, $list[$p]);
$pair_one = $id1."\t".$x;
$pair_two = $id2."\t".$x;
for ($i=0; $i<=$#r; $i++){
chomp ($r[$i]);
($a, $b, $value1, $value2) = split (/\t/, $r[$i]);
$bench = $a."\t".$b;
if (($pair_one eq $bench) || ($pair_two eq $bench)){
print "I don't know what does this script must print!\n";
}
}
}
I'm not able to rationalize about what to print.
Any kind of suggestion is very welcome!
A few general recommendations:
Indent your code to show the structure of your program.
Use meaningful variable names, not $a or $value1 (if I do so below, this is due to my lack of domain knowledge).
Use data structures that suit your program.
Don't do operations like parsing a line more that once.
In Perl, every program should use strict; use warnings;.
use autodie for automatic error handling.
Also, use the open function like open my $fh, "<", $filename as this is safer.
Remember what I said about data structures? In the second file, you have entries like
A X1 2 5
This looks like a secondary key, a primary key, and some data columns. Key-value relationships are best expressed through a hash table.
use strict; use warnings; use autodie;
use feature 'say'; # available since 5.010
open my $data_fh, "<", $data;
my %data;
while (<$data_fh>) {
chomp; # remove newlines
my ($id2, $id1, #data) = split /\t/;
$data{$id1}{$id2} = \#data;
}
Now %data is a nested hash which we can use for easy lookups:
open my $list_fh, "<", $fils_list;
LINE: while(<$list_fh>) {
chomp;
my ($id1, #id2s) = split /\t/;
my $data_id1 = $data{$id1};
defined $data_id1 or next LINE; # maybe there isn't anything here. Then skip
my #values = map #{ $data_id1->{$_} }, #id2s; # map the 2nd level ids to their values and flatten the list
# now print everything out:
say join "\t", $id1, #id2s, #values;
}
The map function is a bit like a foreach loop, and builds a list of values. We need the #{ ... } here because the data structure doesn't hold arrays, but references to arrays. The #{ ... } is a dereference operator.
This is how i would do it, mostly using Hashes resp. Hash- and Array-References (test1.txt and test2.txt contain the data you provided in your example):
use strict;
use warnings;
open(my $f1, '<','test1.txt') or die "Cannot open file1: $!\n";
open(my $f2, '<','test2.txt') or die "Cannot open file2: $!\n";
my #data1 = <$f1>;
my #data2 = <$f2>;
close($f1);
close($f2);
chomp #data1;
chomp #data2;
my %result;
foreach my $line1 (#data1) {
my #fields1 = split(' ',$line1);
$result{$fields1[0]}->{$fields1[1]} = [];
$result{$fields1[0]}->{$fields1[2]} = [];
}
foreach my $line2 (#data2){
my #fields2 = split(' ',$line2);
push #{$result{$fields2[1]}->{$fields2[0]}}, $fields2[2];
push #{$result{$fields2[1]}->{$fields2[0]}}, $fields2[3];
}
foreach my $res (sort keys %result){
foreach (sort keys %{$result{$res}}){
print $res . " " . $_ . " " . join (" ", sort #{$result{$res}->{$_}}) . "\n";
}
}

Merging two files based on first column and returns multiple values for each key

I am fairly new to Perl so hopefully this has a quick solution.
I have been trying to combine two files based on a key. The problem is there are multiple values instead of the one it is returning. Is there a way to loop through the hash to get the 1-10 more values it could be getting?
Example:
File Input 1:
12345|AA|BB|CC
23456|DD|EE|FF
File Input2:
12345|A|B|C
12345|D|E|F
12345|G|H|I
23456|J|K|L
23456|M|N|O
32342|P|Q|R
The reason I put those last one in is because the second file has a lot of values I don’t want but file 1 I want all values. The result I want is something like this:
WANTED OUTPUT:
12345|AA|BB|CC|A|B|C
12345|AA|BB|CC|D|E|F
12345|AA|BB|CC|G|H|I
23456|DD|EE|FF|J|K|L
23456|DD|EE|FF|M|N|O
Attached is the code I am currently using. It gives an output like so:
OUTPUT I AM GETTING:
12345|AA|BB|CC|A|B|C
23456|DD|EE|FF|J|K|L
My code so far:
#use strict;
#use warnings;
open file1, "<FILE1.txt";
open file2, "<FILE2.txt";
while(<file2>){
my($line) = $_;
chomp $line;
my($key, $value1, $value2, $value3) = $line =~ /(.+)\|(.+)\|(.+)\|(.+)/;
$value4 = "$value1|$value2|$value3";
$file2Hash{$key} = $value4;
}
while(<file1>){
my ($line) = $_;
chomp $line;
my($key, $value1, $value2, $value3) = $line =~/(.+)\|(.+)\|(.+)\|(.+)/;
if (exists $file2Hash{$key}) {
print $line."|".$file2Hash{$key}."\n";
}
else {
print $line."\n";
}
}
Thank you for any help you may provide,
Your overall idea is sound. However in file2, if you encounter a key you have already defined, you overwrite it with a new value. To work around that, we store an array(-ref) inside our hash.
So in your first loop, we do:
push #{$file2Hash{$key}}, $value4;
The #{...} is just array dereferencing syntax.
In your second loop, we do:
if (exists $file2Hash{$key}){
foreach my $second_value (#{$file2Hash{$key}}) {
print "$line|$second_value\n";
}
} else {
print $line."\n";
}
Beyond that, you might want to declare %file2Hash with my so you can reactivate strict.
Keys in a hash must be unique. If keys in file1 are unique, use file1 to create the hash. If keys are not unique in either file, you have to use a more complicated data structure: hash of arrays, i.e. store several values at each unique key.
I assume that each key in FILE1.txt is unique and that each unique key has at least one corresponding line in FILE2.txt.
Your approach is then quite close to what you need, you should just use FILE1.txt to create the hash from (as already mentioned here).
The following should work:
#!/usr/bin/perl
use strict;
use warnings;
my %file1hash;
open file1, "<", "FILE1.txt" or die "$!\n";
while (<file1>) {
my ($key, $rest) = split /\|/, $_, 2;
chomp $rest;
$file1hash{$key} = $rest;
}
close file1;
open file2, "<", "FILE2.txt" or die "$!\n";
while (<file2>) {
my ($key, $rest) = split /\|/, $_, 2;
if (exists $file1hash{$key}) {
chomp $rest;
printf "%s|%s|%s\n", $key, $file1hash{$key}, $rest;
}
}
close file2;
exit 0;