Write old fasta header and new to file - perl

Question

I want to extract the old fasta names which looks something like this:
>Bartonella bibbi
AUUCCGGUUGAUCCUGCCGGAGGCCACUGCUAUCGGGGUCCG
The new headers should look like this:
>Seq1
AUUCCGGUUGAUCCUGCCGGAGGCCACUGCUAUCGGGGUCCG
and so on...
The Bartonella Bibbi should be saved together with the new name Seq1 in a new file an so on. So I've started a bit, by looking for lines with >, and then I split to get an array to get the old name. I don't know how to continue, because I want two things here, first to put the new name in there, but also extracting the old name together with the new in a file, and ALSO get an output file with my sequence and my new names. Please, any input from you will help!
#!/usr/bin/perl
use warnings;
use strict;
my $infile = $ARGV[0];
open my $IN, '<', $infile or die "Could not open $infile: $!, $?";
while (my $line = <$IN>) {
if ($line =~ /^>/) {
my #header = split (/\>/, $line);
my $oldfasta = "$header[1]";
}
}
So after some edits, this is the current script:
#!/usr/bin/perl
use warnings;
use strict;
my $infile = $ARGV[0];
open my $IN, '<', $infile or die "Could not open $infile: $!, $?";
my $seqid = 1;
my %id;
while (my $line = <$IN>) {
if ($line =~ /^>/) {
$id{"Seq$seqid "} = $line;
print ">Seq$seqid\n";
$seqid++
} else {
print $line;
}
}
my $outfile = 'output';
open my $OUT, '>', $outfile or die "Could not open $outfile: $!, $?"; # overwrites the file $outfile;
print $OUT %id;
This gives me a file that looks like this:
Seq29 >Sulfophobococcus_zilligii
Seq20 >Pyrococcus_shinkaii
and so on.
They are not in order, how do I sort them and get rid of the > in the species name?

Answer 1

You’re simply not printing anything. Once you add a print statement, it should work.
In addition, it’s unclear what you’re using split for. Just increase a counter for the sequence:
#!/usr/bin/perl
use warnings;
use strict;
my $infile = $ARGV[0];
open my $IN, '<', $infile or die "Could not open $infile: $!, $?";
my $seqid = 1;
while (my $line = <$IN>) {
if ($line =~ /^>/) {
print ">Seq$seqid\n";
$seqid++;
} else {
print $line;
}
}

Answer 2

Simply write the new entries as you create them.
#!/usr/bin/perl
use warnings;
use strict;
my $infile = $ARGV[0];
open my $IN, '<', $infile or die "Could not open $infile: $!, $?";
my $outfile = 'output';
open my $OUT, '>', $outfile or die "Could not open $outfile: $!, $?"; # overwrites the file $outfile;
my $seqid = 1;
while (my $line = <$IN>) {
if ($line =~ /^>(.+)/) {
print $OUT "Seq$seqid\t$1\n"
print ">Seq$seqid\n";
$seqid++
} else {
print $line;
}
}
I tried to fix the indentation but left the gratutious variable for the $OUT file name.
If you want to keep the mapping in memory for other reasons (maybe to develop this into a much more complex script) using an array instead of a hash would seem like a natural way to keep the entries sorted; the new label is trivially derivable from the array index.