Merge Fasta and Qual files with different headers order in FASTQ - perl

Question

I am trying to merge a fasta file and a qual file in a new fastq file having in mind the case that the two files might be provided with different order in their sequence IDs. To do that, I tried the first step of my script to be the sorting of the sequences which works perfectly when I test it as a separate script. The same with the rest, when I run separately the part where it combines the files in a fastq, it runs perfectly. But now that I am trying to combine the two methods in one script it doesn't work and I don't know what else to do! I would appreciate it if you can help me.
Here is my script as far. It creates the new fastq file but the content is messed up and not what I want. I run it from terminal like this:
$ perl script.pl reads.fasta reads.qual > reads.fq
Script :
#!/usr/bin/env perl
use strict;
use warnings;
die ("Usage: script.pl reads.fasta reads.qual > reads.fq") unless (scalar #ARGV) == 2;
open FASTA, $ARGV[0] or die "cannot open fasta: $!\n";
open QUAL, $ARGV[1] or die "cannot open qual: $!\n";
my $offset = 33;
my $count = 0;
local($/) = "\n>";
my %id2seq = ();
my $id = '';
my %idq2seq = ();
my $idq = '';
my (#sort_q, #sort_f);
while(<FASTA>){
chomp;
if($_ =~ /^>(.+)/){
$id = $1;
}else{
$id2seq{$id} .= $_;
}
}
for $id (sort keys %id2seq)
{
#sort_f = "$id\n$id2seq{$id}\n\n";
print #sort_f;
}
while(<QUAL>){
chomp;
if($_ =~ /^>(.+)/){
$idq = $1;
}else{
$idq2seq{$idq} .= $_;
}
}
for $idq (sort keys %idq2seq)
{
#sort_q = "$idq\n$idq2seq{$idq}\n\n";
print "#sort_q";
}
while (my #sort_f) {
chomp #sort_f;
my ($fid, #seq) = split "\n", #sort_f;
my $seq = join "", #seq; $seq =~ s/\s//g;
my $sortq = #sort_q;
chomp my #sortq;
my ($qid, #qual) = split "\n", #sortq;
#qual = split /\s+/, (join( " ", #qual));
# convert score to character code:
my #qual2 = map {chr($_+$offset)} #qual;
my $quals = join "", #qual2; `enter code here`
die "missmatch of fasta and qual: '$fid' ne '$qid'" if $fid ne $qid;
$fid =~ s/^\>//;
print STDOUT (join( "\n", "#".$fid, $seq, "+$fid", $quals), "\n");
$count++;
}
close FASTA;
close QUAL;
print STDERR "wrote $count entries\n";
Thank you in advance

Answer 1

It's been a while since I have used perl, but I would approach this using a hash of key/value pairs for both the fasta and quality input. Then write out all the pairs by looping over the fasta hash and pulling out the corresponding quality string.
I have written something in python that will do what you need, you can see it in action here:
It assumes that your input looks like this:
reads.fasta
>fa_0
GCAGCCTGGGACCCCTGTTGT
>fa_1
CCCACAAATCGCAGACACTGGTCGG
reads.qual
>fa_0
59 37 38 51 56 55 60 44 43 42 56 65 60 68 52 67 43 72 59 65 69
>fa_1
36 37 47 72 34 53 67 41 70 67 66 51 47 41 73 58 75 36 61 48 70 55 46 42 42
output
#fa_0
GCAGCCTGGGACCCCTGTTGT
+
;%&387<,+*8A<D4C+H;AE
#fa_1
CCCACAAATCGCAGACACTGGTCGG
+
$%/H"5C)FCB3/)I:K$=0F7.**
#fa_2
TCGTACAGCAGCCATTTTCATAACCGAACATGACTC
+
C?&93A#:?#F,2:'KF*20CC:I7F9J.,:E8&?F
import sys
# Check there are enough arguments
if len(sys.argv) < 3:
print('Usage: {s} reads.fasta reads.qual > reads.fq'.format(s=sys.argv[0]), file=sys.stderr)
sys.exit(1)
# Initalise dictionaries for reads and qualities
read_dict = dict()
qual_dict = dict()
fa_input = sys.argv[1]
qual_input = sys.argv[2]
# Read in fasta input
with open(fa_input, 'r') as fa:
for line in fa:
line = line.strip()
if line[0] == '>':
read_dict[line[1:]] = next(fa).strip()
else:
next(fa)
# Read in quality input
with open(qual_input, 'r') as qual:
for line in qual:
line = line.strip()
if line[0] == '>':
qual_dict[line[1:]] = next(qual).strip()
else:
next(qual)
count = 0
# Iterate over all fasta reads
for key, seq in read_dict.items():
# Check if read header is in the qualities data
if key in qual_dict.keys():
# There's both sequence and quality data so write stdout
read_str = '#{header}\n{seq}\n+\n{qual}'.format(
header=key,
seq=seq,
qual=''.join([chr(int(x)) for x in qual_dict[key].split(' ')]))
print(read_str, file=sys.stdout)
count += 1
else: # not found
# Write error to stderr
print('Error: {k} not found in qual file'.format(k=key), file=sys.stderr)
# Print count to stderr
print('{c} reads written'.format(c=count), file=sys.stderr)
If you need to use an offset for the quality score edit
qual=''.join([chr(int(x)) for x in qual_dict[key].split(' ')])) to
qual=''.join([chr(int(x) + offset) for x in qual_dict[key].split(' ')])) and define an offset variable before this.