Variable Scope outside foreach loop Perl - perl

Question

Here is the problem:
Generating 10 iterations of 50 iterations and accessing the 50 character string outside the inner foreach loop.
I have tried putting the 50x iteration inside a sub function and calling it, but that was unsuccessful.
Thus far, I only get a single character outside the foreach loop whether it's in a sub function or not. I'm fairly certain this is a scope issue that I'm failing to see.
So, code:
#!/usr/bin/perl
use strict;
use warnings;
my #dna = ('A','G','T','C');
my $i;
my $str;
for ($i=1; $i<11; $i++){
#print $i . " ";
foreach(1..50){
my $nt = int(rand $#dna + 1);
$str = $dna[$nt];
#correct here all 50 nts
print $str;
}
#single nt here
#print $str;
print "\n";
}
Output: Corerct, but I need to access $str as is below but outside the foreach loop and within the first for loop.
TGATTAGCGTCCGCGCGTATTGTATTAAGCCACAGAATGTAATGCCAAGA
GCTATAGGAAGACGCCGATCCCTGGACCGGCACAGGCACGGTAACAGCAG
TTGTTGTAGGATCCCAGGGAGCGAAGCACGTGAACTGCGACTAATTTCAA
TAACCAGGCAACACTAAACAGCTCCCATGTGTAAGGACGTATAGGCAGTT
GTAATTGTAGATCACAAAATTTACACGGTATAGCATTAACTGGAACCTGC
AACAGTGCCGTTTATTAATCTCCTCTAGTGTAGGGACGAATCGACCACGG
CGTGAGCAAGCACAAATATCCTTTAGGGGTGTGCTTAAAACACCCAGTAG
GAGTTCATAGGCCAACAATATGGCAAAGCCTTGCCCCATCAAATTCGGCG
TTGCGTCTGCGAACACTGTTGGTGTGCCTTTAGTGCGGGTTACTCGAGAA
CGCGATCTCCGTTTATAACGCTAGCAAACTACTACGGACCGAGGCATCGC
I removed the extra space in the string. It was superfluous.
This was another attempt at getting to the variable to no avail:
use strict;
use warnings;
my $str;
my #dna = ('A','G','T','C');
for (my $i=1; $i<11; $i++){
fifty();
print $str;
}
sub fifty {
foreach (1 .. 50){
my $nt = int(rand $#dna + 1);
$str = $dna[$nt];
return $str;
}
}

Answer 1

for (my $i=1; $i<11; $i++){
fifty();
Infiftyyou return something but you discard ist, as you do no assignement like $str= fifty();
print $str;
}
And here you print something that has no value yet as it seems - in fact you assign a value in fifty- but you shouldn't use global variables.
sub fifty {
foreach (1 .. 50){
my $nt = int(rand $#dna + 1);
$str = $dna[$nt];
Here you discard whatever is in $str and assign one letter instead. Also you assign to a global variable - which you should avoid.
return $str;
}
}
And here you directly leave fifty and return just the one character - which you (see above) discard.

Answer 2

I found this to work perfectly: Turns out to be scope as far as I could tell and not sure why I was stuck. Regardless, moving on now.
#!/usr/bin/perl
use strict;
use warnings;
my #dna = ('A','G','T','C');
my $i;
my $str;
for ($i=1; $i<11; $i++){
my $filename = "seq_" . $i;
open(my $OUT, '>', $filename) or die("Can't open $filename($!)");
foreach(1..50){
my $nt = int(rand $#dna + 1);
$str = $dna[$nt];
print $OUT $str;
}
close $filename;
}